Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pitaya HuNIP6;1 gene for promoting precocious flowering of plants and application thereof

A technology of early flowering and dragon fruit, applied in plant genetic improvement, angiosperms/flowering plants, applications, etc.

Active Publication Date: 2021-04-30
SOUTH CHINA AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The role of Aquaporin in dragon fruit flowering has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pitaya HuNIP6;1 gene for promoting precocious flowering of plants and application thereof
  • Pitaya HuNIP6;1 gene for promoting precocious flowering of plants and application thereof
  • Pitaya HuNIP6;1 gene for promoting precocious flowering of plants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Screening and cloning of embodiment 1 dragon fruit nocturnal flowering-related genes

[0054] 1. Screening and cluster analysis of dragon fruit nocturnal flowering related genes

[0055]A total of 44 gene sequences were searched using the keyword "Aquaporin" in the dragon fruit genome database. After excluding incomplete MIP domains or incomplete NPA motifs, a structurally complete gene sequence related to the night flowering of dragon fruit was finally screened out. Related gene HuNIP6;1. Use TAIR (https: / / www.arabidopsis.org / ) and NCBI database (https: / / www.ncbi.nlm.nih.gov) to download the full-length amino acid sequence of the Aquaporin gene used to construct the phylogenetic tree, using the maximum likelihood However, the Bootstrap value (set value) of the phylogenetic tree constructed by the MEGAX software is 1000 times, and the result of the phylogenetic tree is as follows figure 1 shown.

[0056] 2. Sequence analysis of HuNIP6;1 gene and physicochemical prope...

Embodiment 2

[0072] Example 2 Analysis of subcellular localization of HuNIP6; 1 ​​gene

[0073] 1. Construction of the carrier

[0074] The carrier of the subcellular localization experiment was pC18-GFP vector, and HindⅢ and BamH I were selected as recombination sites, and primers with vector homology arms (sequences shown in SEQ ID NO.5-6) ​​were designed with Primer Premier 5.0 software. Amplify the full-length cDNA sequence of HuNIP6; 1 ​​gene (not including the stop codon), refer to Instructions for use of HD Cloning kit (TaKaRa, Japan) The amplified product was connected to the pC18-GFP vector, and the PCR recombinant plasmid was transformed into Escherichia coli Transl-T1 competent cells. The method was the same as in Example 1, and the antibiotic was Kan. Use primers with vector homology arms (primer sequences shown in SEQ ID NO.5 and 6) to carry out bacterial liquid PCR detection and sequencing, and sequence the positive strains detected by PCR to obtain pC18-HuNIP6; 1 ​​subcell...

Embodiment 3

[0085] Example 3 HuNIP6; Functional verification of the 1 gene

[0086] 1. Construction of vectors, recombinant plasmids and transformation of Agrobacterium tumefaciens

[0087]The HuNIP6;1 gene was constructed on the expression vector pPZP6k90 driven by 35S, the antibiotic was Kan, the recombination restriction site was Xba I, and the primers whose sequences were shown in SEQ ID NO.7-8 were designed. Then transfer the connected vector plasmid into Agrobacterium GV3101, and save it for future use after being detected as a positive bacterial liquid by PCR. The specific operation is the same as in Example 2. The primer sequences are as follows:

[0088] SEQ ID NO.7:

[0089] CATTCTACAACTACATCTAGAATGGATGCTGAGGATCCCGG;

[0090] SEQ ID NO.8:

[0091] AGCTTGCATGCCAATTCTAGATCATCTCCGGAAGCTTGGTG.

[0092] 2. Transformation of Arabidopsis thaliana mediated by Agrobacterium tumefaciens

[0093] (1) Add 1 mL of the above bacterial solution to 200 mL of YEP medium (containing 100 μg ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pitaya HuNIP6;1 gene for promoting precocious flowering of plants and an application thereof. The invention firstly provides the pitaya HuNIP6;1 gene for promoting precocious flowering of plants, and the nucleotide sequence of the gene is as shown in SEQ ID NO. 1. Through an agrobacterium-mediated arabidopsis genetic transformation method, the function of the gene for regulating and controlling the flowering of the plant is verified, and the fact that the flowering time of a transgenic plant can be obviously earlier than that of a wild type by heterologous expression of the gene is found, so that the gene has the function of regulating and controlling the early flowering of the plant; when the gene is used for plant variety improvement, the harvest period of vegetables or fruits can be shortened, the yield and economic benefits are improved, and germplasm resources are provided for enriching and balancing the crop market in China.

Description

technical field [0001] The present invention relates to the technical field of molecular biology, more specifically, relates to a dragon fruit HuNIP6; 1 ​​gene for promoting early flowering of plants and its application. Background technique [0002] Pitaya, also known as red dragon fruit, fairy fruit, lover fruit, etc., is a cultivated plant of the genus Hylocereus or Selenicereus of the family Cactaceae. As a new fruit with high nutritional value and economic value, dragon fruit has been loved by consumers since it was improved and introduced into my country. Pitaya flower, also known as Jianhua, Bawanghua, Liangtianchihua, etc., is a funnel-shaped lower flower of the ovary. The flower is about 35cm long and 25-30cm in diameter when it is open. It has a strong fragrance and is of great ornamental value. Dragon fruit blooms at night, and the flowers begin to close and wither gradually at dawn, which is a flowering pattern with a diurnal rhythm. In order to improve dragon ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/84C12N1/21C12N15/11C07K14/415A01H5/02A01H6/20C12R1/01
CPCC07K14/415C12N15/827Y02A40/146
Inventor 秦永华叶小滢张志珂胡桂兵赵杰堂
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com