Probe set for detecting amplification level of HER2 gene and application of probe set
A gene amplification and probe set technology, applied in the field of probe sets for detecting the level of HER2 gene amplification, can solve the problems of large number of probes, slow detection results, long detection time, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] This embodiment provides a method for preparing a probe set for detecting the amplification level of the HER2 gene, which specifically includes the following steps:
[0024] S1, based on the sequence of the HER2 gene, design a nucleotide sequence containing 45 bases / 60 bases / 80 bases in the region without repetitive sequences, and set the Tm value of the probe at 50°C. The GC content ranges from 40 to 60%. After discarding the sequences containing AAAA / TTTT / CCCC / GGGG, 1702 candidate probes were obtained. After the whole gene (hg38) BLAST comparison analysis, a total of 1245 nucleotides were finally obtained Sequence, specifically as shown in Table 1 below;
[0025] S2, add a 20bp tag sequence to the 5' end of each nucleotide sequence and a 20bp tag sequence to the 3' end to obtain a series of characteristic primers with tag sequences, wherein the 5' end tag sequence is : TAATACGACTCACTATAGGG, the 3' end tag sequence is: CCGCTGAGCAATAACTAGCA;
[0026] S3, using high-th...
Embodiment 2
[0045] Embodiment 2 Normal people's peripheral lymphocyte droplet experiment
[0046] Materials: human peripheral blood lymphocyte culture medium, colchicine, hypotonic solution (0.4% KCl), fixative solution (methanol:acetic acid=3:1, volume ratio).
[0047] S1, cell culture and synchronization: take 0.4mL heparin anticoagulated whole blood (from the hospital) in human peripheral blood lymphocyte culture medium, mix well and store at 37°C, 5% CO 2 Cultivate in a constant temperature incubator for 72 hours, and 4 hours before termination, add colchicine to the medium to a final concentration (0.1 μg / mL) and continue to cultivate for 4 hours;
[0048] S2, collection and fixation: collect the medium, centrifuge at 500g for 5min, discard the supernatant, add 0.4% KCl hypotonic solution and incubate for 30min, then fix the cells with methanol-glacial acetic acid mixture, let stand at room temperature for 10min, centrifuge at 500g to pellet the cells , repeat the cell fixation step o...
Embodiment 3
[0055] Referring to the method in Example 2, the slide containing 50 metaphase lymphocytes was detected, and the results are shown in Table 3 below. It can be seen that there are 99 FISH signal points of the HER2 gene probe, and the sensitivity reaches 99%.
[0056] Table 3 Sensitivity test results of probes
[0057] probe type Metaphase lymphocytes (units) FISH signal points (pieces) sensitivity HER2 gene probe 50 99 99%
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap