Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of gene editing system

A gene editing and gene technology, applied in the biological field, to achieve good applicability, improve nuclear localization ability, and improve the effect of expression

Pending Publication Date: 2021-06-01
NANJING KGENE GENETIC ENG CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the price of lean meat in cities in my country has nearly doubled the price of fat meat. Lean-meat pigs with a lean meat rate of more than 60% are favored, and there is still room for further improvement in lean meat rate traits.
On the other hand, the weight of fattening pigs in China is about 120kg at present, and it takes about 180 days for pigs to be slaughtered from birth to slaughter. If the growth rate of pigs can be accelerated, the time for slaughtering pigs to be slaughtered can be shortened

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of gene editing system
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of gene editing system
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of gene editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Embodiment 1, the construction of plasmid

[0089] 1.1 Construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

[0090] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO.1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO.1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chickenβ-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal (NLS ), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).

[0091] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO ( Figure 5 ), referred to as plasmid pKG-GE3, the nucleotide is shown in SEQ ID NO.2. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① Remove the residual gRNA backbone seque...

Embodiment 2

[0104] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0105] 2.1 Target gRNA design and construction

[0106] 2.1.1 Using Benchling to design target gRNA for RAG1 gene

[0107] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)

[0108] Synthesize complementary DNA Oligo for the insertion sequence of the above-mentioned RAG1 gene target as follows:

[0109] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0110] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0111] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0112] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target

[0113] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA

[0114] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG

[0115] 2.1.3 Construction and cloning of gRNA recombinant vector

[0116] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;

[0117] 2) Run the digested pKG-U6gRNA plasmid...

Embodiment 3

[0165] Example 3 Screening of efficient MSTN gene gRNA targets

[0166] Pig MSTN gene information: encoding myostatin protein; located on pig chromosome 15; GeneID is 399534, Susscrofa. The protein encoded by the porcine MSTN gene is shown in GENBANK ACCESSION NO.NP_999600.2 (linear CON12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO.13. In the genomic DNA, the porcine MSTN gene has 3 exons, wherein the first exon and its downstream 200bp sequences are shown in SEQ ID NO.14.

[0167] 3.1 Preset targets of MSTN gene knockout and conservation analysis of adjacent genome sequences

[0168] 18 newborn Congjiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D , E, F, G, H).

[0169]Genomic DNA of 18 pigs was used as a template, and primer pairs (the target sequence of the primer pair includes exon 2 of porcine MSTN gene) were used for PCR amplification, followed by electrophoresis. The PCR amplification products were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of the gene editing system. The invention discloses a CRISPR / Cas9 system for pig MSTN-SST-INHA gene editing. The CRISPR / Cas9 system comprises a Cas9 expression vector, a gRNA expression vector aiming at a pig MSTN gene, a gRNA expression vector aiming at a pig SST gene and a gRNA expression vector aiming at a pig INHA gene; and the plasmid complete sequence of the Cas9 expression vector is as shown in SEQ ID NO. 2. According to the invention, corresponding gRNA expression vectors are respectively designed aiming at different targets of MSTN, SST and INHA genes, and gRNA with relatively high editing efficiency and the expression vector thereof are obtained through screening. The modified Cas9 efficient expression vector is used for gene editing, and the editing efficiency is remarkably improved compared with that of an original vector.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a CRISPR / Cas9 system for gene editing of MSTN, SST and INHA and its application in the construction of high-quality pig nuclear transfer donor cells with high lean meat rate, fast growth and high fecundity . Background technique [0002] Pig is one of the earliest domesticated domestic animals in my country, and it has always been an important meat animal for human beings in the long river of history. The Chinese love to eat pork is related to the food culture for thousands of years. Since 2000, pork has accounted for more than 70% of my country's meat consumption, and it is the most important meat consumed in my country. At present, the price of lean meat in cities in my country has nearly doubled the price of fat meat. Lean-meat pigs with a lean meat rate of more than 60% are favored, and there is still room for further improvement in lean meat rate traits. On the ot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/55C12N15/16C12N15/12C12N15/10C12N5/10
CPCC07K14/475C07K14/575C07K14/655C12N5/0656C12N9/22C12N15/102C12N15/85C12N2510/00C12N2517/02C12N2800/107C12N2830/48C12Q2521/327C12Q2525/161
Inventor 牛冬汪滔马翔曾为俊王磊程锐赵泽英段星刘璐陶裴裴黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com