Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and high reproductive capacity and application of gene editing system
A gene editing and gene technology, applied in the biological field, to achieve good applicability, improve nuclear localization ability, and improve the effect of expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Embodiment 1, the construction of plasmid
[0089] 1.1 Construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)
[0090] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO.1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO.1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chickenβ-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal (NLS ), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).
[0091] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO ( Figure 5 ), referred to as plasmid pKG-GE3, the nucleotide is shown in SEQ ID NO.2. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① Remove the residual gRNA backbone seque...
Embodiment 2
[0104] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3
[0105] 2.1 Target gRNA design and construction
[0106] 2.1.1 Using Benchling to design target gRNA for RAG1 gene
[0107] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)
[0108] Synthesize complementary DNA Oligo for the insertion sequence of the above-mentioned RAG1 gene target as follows:
[0109] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)
[0110] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)
[0111] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.
[0112] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target
[0113] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA
[0114] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG
[0115] 2.1.3 Construction and cloning of gRNA recombinant vector
[0116] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;
[0117] 2) Run the digested pKG-U6gRNA plasmid...
Embodiment 3
[0165] Example 3 Screening of efficient MSTN gene gRNA targets
[0166] Pig MSTN gene information: encoding myostatin protein; located on pig chromosome 15; GeneID is 399534, Susscrofa. The protein encoded by the porcine MSTN gene is shown in GENBANK ACCESSION NO.NP_999600.2 (linear CON12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO.13. In the genomic DNA, the porcine MSTN gene has 3 exons, wherein the first exon and its downstream 200bp sequences are shown in SEQ ID NO.14.
[0167] 3.1 Preset targets of MSTN gene knockout and conservation analysis of adjacent genome sequences
[0168] 18 newborn Congjiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D , E, F, G, H).
[0169]Genomic DNA of 18 pigs was used as a template, and primer pairs (the target sequence of the primer pair includes exon 2 of porcine MSTN gene) were used for PCR amplification, followed by electrophoresis. The PCR amplification products were...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



