Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application of dual-induction mCreER system

A cell differentiation and traceable technology, applied in the field of cell lineage tracing, can solve the problems of genome damage to cells, reduced reliability of tracing results, leakage, etc., to achieve the effect of improving tissue specificity, reducing off-target phenomena, and reducing cytotoxicity

Active Publication Date: 2021-06-08
SHANTOU UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Spontaneous recombination causes non-target cells to be marked in advance, seriously affecting accurate tracking
In addition to spontaneous recombination, if Cre or CreER stays in the nucleus for a long time, it may bind to recessive target sites, causing genome damage and cytotoxicity, thus affecting the analysis and judgment of experimental results
[0004] Although the CreER-loxP tracking system plays an irreplaceable role in the study of individual and tissue development, it also has some technical bottlenecks
The Cre recombinase mainly relied on by this technology has problems of spontaneous leakage, ectopic expression and cytotoxicity, which greatly reduces the reliability of the tracking results, and this has become one of the main reasons for the controversy of many scientific issues in recent years

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application of dual-induction mCreER system
  • Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application of dual-induction mCreER system
  • Dual-induction mCreER system capable of tracking cell differentiation and development and establishment and application of dual-induction mCreER system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. The establishment principle of a dual-induction mCreER system that can track cell differentiation and development is as follows: figure 1 As shown in A, the mCreER and mTEVp proteins are respectively connected to CD8 located on the cell membrane through the FRB protein and the FKBP protein, and are correspondingly fixed on the cell membrane; when the inducer rapamycin is added, the FKBP protein and the FRB protein Close to each other and combine to form a complex, induce the cleavage of mTEVp protein, release mCreER from the plasma membrane, and enter the nucleus under the action of the inducer tamoxifen to mediate loxP site recombination, realizing the controllability of recombination time. The gene sequence of the mCreER is shown in the sequence listing SEQ ID NO:1; the gene sequence of the mTEVp protein is shown in the sequence listing SEQ ID NO:2. The gene of the mCreER must encode the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing; the gene of...

Embodiment 2

[0055] Intracellular localization verification of traditional CreER system and dual-inducible mCreER system.

[0056] 1. Construction of pCMV-CreER-EGFP plasmid: Use Nhe and EcoRI enzymes to obtain the vector backbone of the pCMV-EGFP-N1 plasmid, digest the CreER fragment obtained by PCR amplification, connect the fragment to the above vector backbone, and perform digestion and sequencing After verification, the recombinant pCMV-CreER-EGFP was obtained.

[0057] F-primer(5'→3')R-primer(5'→3')

[0058] CGGCTAGCCGATGGC GAATTCGAGCTGTGGCAGGGA CAATTTACTGACCGTACA AACCC

[0059] 2. Immunofluorescence staining to verify the location of CreER in the cells mainly includes the following steps: (1) After transfecting the cells of the traditional CreER system and the double-induced mCreER system, the cell culture medium was aspirated, washed once with PBS, and 4% polymer was added. Formaldehyde fixation for 15 minutes. (2) Wash three times with PBS, 3 minutes each time, add 0.2% Trito...

Embodiment 3

[0063] HSP90 plays an important role in the stringency of the mCreER system

[0064] Ad293 was co-transfected with pCMV-mCreER / pCMV-mTEVp plasmid, the inducer was added 24 hours after transfection, the cells were collected and lysed after 24 hours of induction, and the expression levels of CreER, CD8a and HSP90 were verified by co-immunoprecipitation and WB, indicating that HSP90 has a positive effect on the mCreER system important role. After the HSP90 protein was knocked down by siRNA, the stringency of mCreER system labeling cells was greatly reduced, and serious leakage occurred. It is speculated that HSP90 protein binds to ER, which can seal the CS site and effectively prevent TEVp enzyme from cutting the CS site. When tamoxifen is added, the conformation of ER changes, dissociates from the anchored HSP90, and Under the mediation of nuclear signal, CreER protein enters the nucleus and recombines the Loxp site. The results of studying the mechanism of mCreER system by co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a dual-induction mCreER system capable of tracking cell differentiation and development. The dual-induction mCreER system comprises mCreER protein and mTEVp protein, wherein the mCreER protein and the mTEVp protein are connected with CD8 positioned on a cell membrane through FRB protein and FKBP protein, and are correspondingly fixed on the cell membrane; and when rapamycin is added, FKBP protein and FRB protein approach each other and are combined to form a complex, cutting of mTEVp protein is induced, mCreER is released from plasma membrane and enters a nucleus under the action of tamoxifen to mediate loxP site recombination, and controllability of recombination time is achieved. According to the dual-induction mCreER system, the Cre recombinase can enter a cell nucleus for recombination only under the induction condition, and the spontaneous recombination phenomenon of a traditional CreER system is avoided. The mCreER is membrane protein, the relative expression quantity is relatively low, and after the mCreER is induced to enter the cell nucleus, the off-target phenomenon of Cre recombinase can be reduced, the cytotoxicity is reduced, and the tissue specificity is improved; and the tissue cells can be tracked more strictly and accurately, and a new thought is provided for cell development, tissue regeneration and disease treatment.

Description

technical field [0001] The invention relates to a cell lineage tracing technology, in particular to a dual-induction mCreER system capable of tracing cell differentiation and development and its establishment and application. Background technique [0002] Cell lineage tracing refers to the use of different methods to mark cells, and to track and observe the proliferation, migration and differentiation activities of all cells of their progeny, which provides an important means for studying tissue cell development, single cell differentiation and disease occurrence. Tracing the origin and properties of cells can help to better understand pathogenesis and provide new insights into disease treatment. Cell lineage tracing techniques mainly include direct observation, staining and labeling of target cells, transplantation and labeling of cells and tissues, genetic mosaic and CreER-Loxp system labeling, etc. Compared with traditional tracing methods, CreER-loxP system labeling has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/66C12N15/62
CPCC12N15/85C07K14/70517C07K14/721C12N9/506C12N9/1241C12N2800/107C12N2800/30C07K2319/50C07K2319/70C07K2319/00
Inventor魏炽炬陈勉乔田雄
OwnerSHANTOU UNIV