Method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli

A technology of recombinant Escherichia coli, Escherichia coli, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve the problems of low yield and high cost of fumarate

Active Publication Date: 2021-07-02
TAIZHOU UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is that the yield of fumarase extraction is low and the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli
  • Method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli
  • Method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The acquisition of embodiment 1 recombinant escherichia coli

[0034] Primers were designed based on the fumarase gene fumC sequence of D. radiodurans (GenBank: CP015081.1), and enzyme cleavage sites and protective bases were added to the 5' end of the primers: DR2627up, gacacCATATG accaaaacccgccaagaaacc (SEQ ID No.1), the underline shows the NdeI restriction site and the protection base; DR2627dn, gacac CTCGAGg ttgtgagtcatgcccagcgg (SEQ ID No. 2), the underline shows the XhoI restriction site and the protected base.

[0035] Genomic DNA of D. radiodurans (D. radiodurans) was extracted, and then PCR amplification was carried out with DR2627up and DR2627dn as primers and the genomic DNA of D. radiodurans as a template. Anneal at 58°C for 30s, extend at 72°C for 120s), 35 cycles in brackets; extend at 72°C for 6min; keep at 4°C), and identify by electrophoresis. Such as figure 1 As shown in (a), a nucleic acid band with a size of about 1400 bp was obtained by PCR a...

Embodiment 2

[0039] The screening of embodiment 2 synthetic L-malic acid method

[0040] Product detection method: 10mL of mass concentration 10% sodium fumarate solution (sodium hydroxide to adjust pH) contains 0.1g of wet bacterial cells, reacts in a water bath for 10h, and utilizes high performance liquid chromatography (HPLC) to detect the L-malic acid. HPLC detection of L-malic acid Chromatographic conditions: chromatographic column: WATERS C18 hydrophilic column; mobile phase: 0.1% mass concentration of formic acid plus 5% acetonitrile buffer solution, flow rate 0.8mL min -1 , the column temperature was 23° C., the ultraviolet detection wavelength was 210 nm, and the injection volume was 10 μL.

[0041] 1. Effect of transformation temperature on the activity of recombinant fumarase

[0042] The pH of the reaction solution is 7.0, the substrate concentration is 0.1g / mL, and 0.1g of wet bacterial cells, and the enzyme-catalyzed reaction can be performed at a suitable temperature to m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biological enzyme synthesis, and particularly relates to a method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli. The invention aims to solve the technical problems of low yield and high cost of fumarase extraction. According to the technical scheme, the method for synthesizing the L-malic acid through the recombinant escherichia coli specifically comprises the following steps: constructing escherichia coli engineering bacteria for expressing a fumarase gene, performing liquid culture on the engineering bacteria, adding a reaction substrate sodium fumarate, performing whole-cell catalysis until the reaction is complete, and collecting reaction liquid. According to the application, L-malic acid is produced by using sodium fumarate as a conversion substrate through recombinant escherichia coli whole cells by utilizing a molecular biological technology. The yield of the L-malic acid in the method can reach 95%. The invention provides a direction for the research of increasing the yield of malic acid and lays a foundation for the research of other organic acids.

Description

technical field [0001] The invention relates to the technical field of biological enzyme synthesis, in particular to a method for catalyzing the synthesis of L-malic acid by using recombinant Escherichia coli whole cells. Background technique [0002] Malic acid, also known as 2-hydroxysuccinic acid, is a very common but very important natural organic acid, and its ionization constant K1 is 4.0×10 -4 , K2 is 9×10 -6 , is one of the members of the tricarboxylic acid cycle in organisms. There is an asymmetric carbon atom in the molecule, and there are two enantiomers, namely L-malic acid and D-malic acid, which are left-handed and right-handed respectively. It has a wide range of uses in many fields, and there are many methods for producing malic acid, such as chemical synthesis, biosynthesis, direct fermentation (also known as one-step fermentation), two-step fermentation, enzyme conversion, and direct extraction. Wait. Among them, the chemical synthesis method synthesize...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P7/46C12N9/88C12R1/19
CPCC12N9/88C12P7/46C12Y402/01002Y02P20/50
Inventor 尹龙飞付永前罗希郑伟龙孙小龙
Owner TAIZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap