Method for synthesizing L-malic acid through whole-cell catalysis of recombinant escherichia coli
A technology of recombinant Escherichia coli, Escherichia coli, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve the problems of low yield and high cost of fumarate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The acquisition of embodiment 1 recombinant escherichia coli
[0034] Primers were designed based on the fumarase gene fumC sequence of D. radiodurans (GenBank: CP015081.1), and enzyme cleavage sites and protective bases were added to the 5' end of the primers: DR2627up, gacacCATATG accaaaacccgccaagaaacc (SEQ ID No.1), the underline shows the NdeI restriction site and the protection base; DR2627dn, gacac CTCGAGg ttgtgagtcatgcccagcgg (SEQ ID No. 2), the underline shows the XhoI restriction site and the protected base.
[0035] Genomic DNA of D. radiodurans (D. radiodurans) was extracted, and then PCR amplification was carried out with DR2627up and DR2627dn as primers and the genomic DNA of D. radiodurans as a template. Anneal at 58°C for 30s, extend at 72°C for 120s), 35 cycles in brackets; extend at 72°C for 6min; keep at 4°C), and identify by electrophoresis. Such as figure 1 As shown in (a), a nucleic acid band with a size of about 1400 bp was obtained by PCR a...
Embodiment 2
[0039] The screening of embodiment 2 synthetic L-malic acid method
[0040] Product detection method: 10mL of mass concentration 10% sodium fumarate solution (sodium hydroxide to adjust pH) contains 0.1g of wet bacterial cells, reacts in a water bath for 10h, and utilizes high performance liquid chromatography (HPLC) to detect the L-malic acid. HPLC detection of L-malic acid Chromatographic conditions: chromatographic column: WATERS C18 hydrophilic column; mobile phase: 0.1% mass concentration of formic acid plus 5% acetonitrile buffer solution, flow rate 0.8mL min -1 , the column temperature was 23° C., the ultraviolet detection wavelength was 210 nm, and the injection volume was 10 μL.
[0041] 1. Effect of transformation temperature on the activity of recombinant fumarase
[0042] The pH of the reaction solution is 7.0, the substrate concentration is 0.1g / mL, and 0.1g of wet bacterial cells, and the enzyme-catalyzed reaction can be performed at a suitable temperature to m...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap