Graphene biosensor, preparation method and method for detecting escherichia coli

Abstract

The invention discloses a graphene biosensor, a preparation method and a method for detecting escherichia coli. The graphene biosensor comprises a junction field effect transistor, a source electrode and a drain electrode of the junction field effect transistor are connected through a graphene film, a sample pool is arranged on the graphene film, a grid electrode is arranged on the sample pool, and the graphene film loads a nucleic acid aptamer; the sequence of the nucleic acid aptamer from the 5' end to the 3' end is ATCCGTCACCTGCTACGGCGCTCACCACGGCCTCTACGGCCTCTACGGCATATGGTGTTGGCTCCGTAT. The graphene biosensor provided by the invention can be used for carrying out specific detection on escherichia coli, is high in detection sensitivity, simple to operate and low in cost, and has relatively high sensitivity and good safety under relatively low use voltage.

Description

technical field [0001] The invention belongs to the technical field of microorganism detection, and relates to a graphene biosensor, a preparation method and a method for detecting Escherichia coli. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Escherichia coli (Escherichia coli, E.coli), also known as Escherichia coli, was first discovered by German scientist Theodor Escherich in 1985. It is a Gram-negative bacterium and a representative bacterium of the genus Escherichia. The size is about 0.5-1.3 μm, and it has tenacious resistance in nature and can survive in various water bodies. Escherichia coli mainly attaches to the intestinal tract of humans or animals, and is...

AI Technical Summary

Problems solved by technology

However, although the traditional detection method has a wide range of applications and high precision, the process is complicated, the entire detection cycle is long, and the requirements for the skills of the experimental operators are relatively high.

Modern detection methods mainly include methods based on immunology, such as enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) technology, etc., but these experiments require enrichment experiments, and the cost is high; Fluorescence methods for detection and electrochemical methods based on biosensors, etc.

However, these detection methods still have shortcomings such as complicated operation, high cost, low precision, and long cycle.

Images