Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Abiotic stress inducible promoter and application thereof

A promoter and non-biological technology, applied in the field of plant genetic engineering, can solve problems such as death, affect normal growth, increase the burden of plant metabolism, etc., and achieve the effect of enhancing stress resistance and increasing expression level

Active Publication Date: 2021-07-23
XINJIANG AGRI UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, in the improvement of crops by transgenic technology, the most widely used constitutive promoter is the cauliflower mosaic virus 35S promoter (CaMV35S), which can drive its downstream genes to be highly expressed in all stages of plant growth and in tissues and organs. It not only increases the metabolic burden of plants, affects normal growth, but may also lead to their death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Abiotic stress inducible promoter and application thereof
  • Abiotic stress inducible promoter and application thereof
  • Abiotic stress inducible promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Cloning and sequencing of embodiment 1GhHSP70 gene promoter

[0058] According to the https: / / cottonfgd.org / website, the promoter sequence (SEQ ID No.1) of the GhHSP70 gene (Ghir_D06G018900.1) was obtained, and the primers P-F1 / P-R1 were designed to use the upland cotton variety "Shiyuan 321" and upland cotton Genomic DNA from leaves of cotton variety "Xinluzao 26" was used as a template for PCR amplification.

[0059] P-F1: TCTCTTATGGTTGGGTTGGGAC

[0060] P-R1: TACGGTTGCCTTGGTCGTTG

[0061] The PCR amplification system and reaction program are shown in Table 1:

[0062] Table 1 PCR amplification reaction system and reaction program

[0063]

[0064] Among them, 5× FastPfuFly buffer and FastPfu Fly DNAPolymerase is from Quanshijin Biological Co., Ltd.

[0065] The amplified PCR product was detected by 1.0% agarose gel electrophoresis.

[0066] Recovery and purification of PCR amplification products:

[0067] The PCR product was separated by 1% agarose gel ...

Embodiment 2

[0082] Example 2 Identification of cotton promoter-driven GhHSP70 gene expression pattern under abiotic stress treatment

[0083] In order to detect the differences in the expression patterns of the GhHSP70 gene driven by the mutant promoters PHSPIn9 (Shiyuan 321) and PHSPDel (Xinluzao 26) in different cotton materials, cotton seedlings with 4-5 true leaves were treated with 15% PEG (polyethylene glycol). Diol) nutrient solution (the liquid obtained by adding PEG to 15% of the PEG content in 1 / 2 Hoagland nutrient solution) was treated for 6 h, and the 250 mM NaCl nutrient solution (the liquid obtained by adding NaCl to the NaCl content in 1 / 2 Hoagland nutrient solution was 250 mM) ), 100 μM ABA (abscisic acid, Abscisic acid) nutrient solution (add ABA to 1 / 2 Hoagland nutrient solution until the ABA content is 100 μM) and 100 μM SA (salicylic acid) nutrient solution (add 1 / 2 Hoagland nutrient solution The solution obtained by adding SA until the SA content was 100 μM) was treat...

Embodiment 3

[0084] Example 3, PHSPIn9 and PHSPDel are abiotic stress-inducible promoters

[0085] 1. Construction of the carrier

[0086] Using the plasmid DNA of the correct sequenced promoter monoclonal strains of Zhongshiyuan 321 and Xinluzao 26 in Example 1 respectively as templates, PCR amplification was carried out by HindIII-P-F / NcoI-P-R primers, and different gene promoters were added. connector. (The underlined part is the recognition site of restriction endonuclease HindIII and NcoI respectively)

[0087] HindIII-P-F:

[0088] NcoI-P-R:

[0089] The PCR amplification system and program are shown in Table 2:

[0090] Table 2 PCR amplification reaction system and program

[0091]

[0092] The PCR product was purified with a DNA product purification kit (TIANquick Midi Purification Kit).

[0093] The purified PCR product and pCAMBIA3301 (commercially available) were double digested with HindIII and NcoI endonucleases to purify the digested product. The enzyme digestio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an abiotic stress inducible promoter and an application thereof. The invention specifically discloses a DNA molecule. The DNA molecule is an inducible promoter PHSPIn9 and an inducible promoter PHSPDel. The promoter is derived from a GhHSP70 gene dominant haplotype promoter in upland cotton, the expression quantity of a GUS gene driven by the promoter under the abiotic stress is detected, and the result shows that both the PHSPIn9 promoter and the PHSPDel promoter can enhance the expression level of the GUS gene under the abiotic stress condition. The relative expression level of the GUS gene driven by the PHSPIn9 promoter is remarkably higher than that of the PHSPDel and CaMV35S. The developed abiotic stress inducible promoter provides an excellent tool for directional expression of genes for genetic engineering breeding of plants for coping with abiotic stress such as high temperature and drought, and has important significance for research and production practice of a plant genetic engineering technology.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to an abiotic stress-inducible promoter and its application, in particular to the development and application of an abiotic stress-inducible promoter PHSPIn9 / PHSPDel derived from cotton. Background technique [0002] The promoter is a DNA sequence located in the upstream region of the 5' end of the structural gene, which can accurately bind to transcription-related proteins such as RNA polymerase, and has the specificity of transcription initiation. It is an important component of gene expression regulation and controls gene expression. Onset and degree of expression. The plant gene promoter contains a variety of important cis-acting elements, which participate in the regulation of the expression of the corresponding downstream genes at the transcriptional level, making the gene specific in time and space. Therefore, the isolation and functional analysis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/20A01H6/60
CPCC12N15/113C12N15/8237C12N2830/002
Inventor 陈全家郭亚萍郑凯陈琴曲延英
Owner XINJIANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com