Abiotic stress inducible promoter and application thereof
A promoter and non-biological technology, applied in the field of plant genetic engineering, can solve problems such as death, affect normal growth, increase the burden of plant metabolism, etc., and achieve the effect of enhancing stress resistance and increasing expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Cloning and sequencing of embodiment 1GhHSP70 gene promoter
[0058] According to the https: / / cottonfgd.org / website, the promoter sequence (SEQ ID No.1) of the GhHSP70 gene (Ghir_D06G018900.1) was obtained, and the primers P-F1 / P-R1 were designed to use the upland cotton variety "Shiyuan 321" and upland cotton Genomic DNA from leaves of cotton variety "Xinluzao 26" was used as a template for PCR amplification.
[0059] P-F1: TCTCTTATGGTTGGGTTGGGAC
[0060] P-R1: TACGGTTGCCTTGGTCGTTG
[0061] The PCR amplification system and reaction program are shown in Table 1:
[0062] Table 1 PCR amplification reaction system and reaction program
[0063]
[0064] Among them, 5× FastPfuFly buffer and FastPfu Fly DNAPolymerase is from Quanshijin Biological Co., Ltd.
[0065] The amplified PCR product was detected by 1.0% agarose gel electrophoresis.
[0066] Recovery and purification of PCR amplification products:
[0067] The PCR product was separated by 1% agarose gel ...
Embodiment 2
[0082] Example 2 Identification of cotton promoter-driven GhHSP70 gene expression pattern under abiotic stress treatment
[0083] In order to detect the differences in the expression patterns of the GhHSP70 gene driven by the mutant promoters PHSPIn9 (Shiyuan 321) and PHSPDel (Xinluzao 26) in different cotton materials, cotton seedlings with 4-5 true leaves were treated with 15% PEG (polyethylene glycol). Diol) nutrient solution (the liquid obtained by adding PEG to 15% of the PEG content in 1 / 2 Hoagland nutrient solution) was treated for 6 h, and the 250 mM NaCl nutrient solution (the liquid obtained by adding NaCl to the NaCl content in 1 / 2 Hoagland nutrient solution was 250 mM) ), 100 μM ABA (abscisic acid, Abscisic acid) nutrient solution (add ABA to 1 / 2 Hoagland nutrient solution until the ABA content is 100 μM) and 100 μM SA (salicylic acid) nutrient solution (add 1 / 2 Hoagland nutrient solution The solution obtained by adding SA until the SA content was 100 μM) was treat...
Embodiment 3
[0084] Example 3, PHSPIn9 and PHSPDel are abiotic stress-inducible promoters
[0085] 1. Construction of the carrier
[0086] Using the plasmid DNA of the correct sequenced promoter monoclonal strains of Zhongshiyuan 321 and Xinluzao 26 in Example 1 respectively as templates, PCR amplification was carried out by HindIII-P-F / NcoI-P-R primers, and different gene promoters were added. connector. (The underlined part is the recognition site of restriction endonuclease HindIII and NcoI respectively)
[0087] HindIII-P-F:
[0088] NcoI-P-R:
[0089] The PCR amplification system and program are shown in Table 2:
[0090] Table 2 PCR amplification reaction system and program
[0091]
[0092] The PCR product was purified with a DNA product purification kit (TIANquick Midi Purification Kit).
[0093] The purified PCR product and pCAMBIA3301 (commercially available) were double digested with HindIII and NcoI endonucleases to purify the digested product. The enzyme digestio...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com