Method for mining microorganism anti-heavy metal function based on conserved sequence clustering analysis

A conservative sequence and anti-heavy metal technology, applied in the field of microorganisms, can solve problems such as high failure probability, heavy workload, and high degree of genetic variation, and achieve accurate mining results

Pending Publication Date: 2021-07-23
NORTHWEST A & F UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The difficulty in solving the above problems and defects is: microorganisms are the most diverse life forms on the earth. To understand the anti-heavy metal performance of microorganisms through stress screening, we face the disadvantages of heavy workload and high failure probability.
At the same time, the genetic structure of microorganisms is simple, and the degree of genetic variation is high, so there is often great uncertainty in the function of direct mining of genetic material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for mining microorganism anti-heavy metal function based on conserved sequence clustering analysis
  • Method for mining microorganism anti-heavy metal function based on conserved sequence clustering analysis
  • Method for mining microorganism anti-heavy metal function based on conserved sequence clustering analysis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The implementation process of the microbial anti-heavy metal function mining method based on conservative sequence cluster analysis provided by the embodiments of the present invention is as follows:

[0049] (1) Conserved sequence determination and molecular identification of the target strain. Different microorganisms have different conserved sequences at different taxonomic levels. In this step, recognized conserved sequences, such as bacterial 16S sequence, fungal ITS sequence, mitochondrial COX1 gene sequence, etc., can be used, or the target strain can be determined by comparing the known sequence information of the family or genus to which the target strain belongs. Specific conserved sequence segments. After determining the conserved sequence segment, determine the conserved sequence of the target strain. Establish a phylogenetic tree to re-determine the species of the target strain.

[0050] (2) Establish a microbial anti-heavy metal database and enter known...

Embodiment 2

[0054] (1) Conserved sequence determination and molecular identification. Select a bacterium of unknown species and unknown function, select the 16S rDNA, which is recognized as a conserved sequence by the bacterium, as the conserved sequence, use the kit to extract the DNA of the bacterial strain, use the extracted total DNA as a template, and use 16S rRNA primers for PCR amplification. The primer is: 27FAGAGTTTGATCCTGGCTCAG, and the reverse primer is: 1492RGGTTACCTT GTTACGACTT. 20ul Taq reaction system, including 10×TaqBuffer 2ul, 2mM dNTPs 2ul, 25mM MgSO4 1.2ul, Taq enzyme 1ul, Primer1 (10pm) 1ul, Primer2 (10pm) 1ul, Plate 1ul, PCR enhancer 5ul, H2O 5.8ul, after amplification sequencing. The 16S sequence of the bacterium was determined, and the determination result is shown in sequence 1. Species phylogenetic relationship was identified based on conserved sequences, and species phylogenetic trees were constructed. The bacterium was identified as Bacillus cereus ( figur...

Embodiment 3

[0063](1) Conserved sequence determination and molecular identification. Two strains of fungi with similar morphology were obtained from the slag of an antimony mine. The genomic DNA of the fungus was extracted, and the ITS region of the tolerant fungus was amplified by PCR using the forward primer ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and the reverse primer ITS4 (5'-TCCTCCGTTATTGATATGC-3'). The PCR amplification system conditions are (50 μL): 2×TaqPCR mix 25 μL (including Taq DNA polymerase, dNTPs, MgCl2, reaction buffer), Forward primer (10 μmol L-1) 2 μL, Reverse primer (10 μmol L-1) 2 μL, Template 1μL, ddH2O 20μL. PCR cycling conditions: 98°C 2min; 98°C 10s; 54°C 10s, 72°C 10s, 35 cycles; 72°C 5min. After the PCR amplification products were sequenced, the ITS sequences of the above-mentioned fungi were determined, and the sequence information is shown in Table 2. The obtained gene sequence was subjected to BLAST analysis in National Center for Biotechnology Information (NCBI...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microorganisms, and discloses a method for mining microorganism anti-heavy metal function based on conserved sequence clustering analysis, including: target strain conserved sequence determination and molecular identification; establishing a microorganism anti-heavy metal database and inputting known microorganism anti-heavy metal information; clustering target strains based on conserved sequences; and verifying the anti-heavy metal function of the target strain. According to the invention, on the basis of database information and conserved sequences, microorganisms with unknown anti-heavy metal function and microorganisms with known anti-heavy metal function are subjected to clustering analysis, possible anti-heavy metal types of the microorganisms are mined, which can provide indication directions for mining microorganism anti-heavy metal types, blindness of microorganism anti-heavy metal screening is avoided, the screening efficiency is improved, and reference is provided for development of anti-heavy metal function. The method provided by the invention is eatablished on the basis of the relationship between heredity and functions, the specific functions of microorganisms are mined by utilizing biomolecular information, and potential judgment can be carried out on the resistance characteristics of target strains to various heavy metals.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a method for mining anti-heavy metal functions of microorganisms based on conservative sequence clustering analysis. Background technique [0002] At present, there are many types, complex types and diverse functions of microorganisms, which provide many possible ways to use microorganisms to solve environmental problems. Environmental remediation based on the anti-heavy metal performance of microorganisms is currently a research hotspot and key application field for environmental pollution remediation using microorganisms. He Shengbao and others have invented a microbial strain that "repairs heavy metal-contaminated soil" by using the anti-heavy metal performance of microorganisms. and its application" (ZL 201610655203.3), which can effectively passivate the exchangeable cadmium in the soil, significantly reduce the content of exchangeable cadmium, and at the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6895C12Q1/70C12Q1/6869G16B30/00G16B40/00
CPCC12Q1/689C12Q1/6895C12Q1/701C12Q1/6869G16B30/00G16B40/00
Inventor徐正刚赵运林杨桂燕黄慧敏李朝阳马凯恒王田雨
OwnerNORTHWEST A & F UNIV