Unlock instant, AI-driven research and patent intelligence for your innovation.

Bicistronic DNA vaccine for grouper viral nervous necrosis

A DNA vaccine and bicistronic technology, applied in the field of fish immunology, can solve the problems of not very good antigen immunogenicity, not very good immune protection effect, limited immune protection effect of fish body, etc., to enhance humoral immunity , Good immune protection effect, the effect of enhancing the ability to resist nerve necrosis virus infection

Active Publication Date: 2021-08-31
OCEAN UNIV OF CHINA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the immune protection effect caused by the DNA vaccine against the current single antigen is not very good, and from the existing results, all the capsid proteins as antigens can only cause humoral immunity of fish in a small part, and the immunogenicity of the antigen is also low. Not very good, and the immune protection effect provided to fish is also limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bicistronic DNA vaccine for grouper viral nervous necrosis
  • Bicistronic DNA vaccine for grouper viral nervous necrosis
  • Bicistronic DNA vaccine for grouper viral nervous necrosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The preparation method of anti-NNV bicistronic DNA vaccine comprises the steps:

[0028] 1. Construction of recombinant eukaryotic plasmids:

[0029]1. According to the multiple cloning site in the pBudCE4.1 plasmid and the sequence of the grouper interferon regulatory factor 3 and the NNV capsid protein (MT157514.1), use the primer design software Primer 5.0 to design the sequences with NotI, KpnI and Forward and reverse primers for Hindlll and EcoRI restriction sites,

[0030] IRF-3-F: ATTTGCGGCCGCATGTCTCATTCTAAACCACT;

[0031] IRF-3-R: CGGGGTACCGTACATCTCCCATCATCATCTCCTC;

[0032] CP-F: CGGAATTCATGGTACGCAAAGGTGAGAAG;

[0033] CP-R: GCGTCGACTTAGTTTTCCGAGTCAACCCT.

[0034] 2. Amplification and purification of the target gene: the IRF-3 gene was amplified by artificially synthesizing specific primers using the genomic DNA of the head and kidney of the pearl gentian grouper. The reaction conditions were: pre-denaturation at 95°C for 5 minutes; 35 cycles at 95°C for 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a bicistronic DNA vaccine for grouper viral nervous necrosis, which is a recombinant eukaryotic expression vector, and the recombinant eukaryotic expression vector can simultaneously express P-domain of nervous necrosis virus capsid protein and superfamily structural domain of garrupa interferon regulatory factor 3 protein. The bicistronic DNA vaccine for resisting the nervous necrosis virus, prepared by the invention, is transfected into a fish body, so that a nervous necrosis virus capsid protein P-domain and a superfamily structural domain of interferon regulatory factor 3 protein of a host can be well expressed. The prepared nervous necrosis virus resistant bicistronic DNA vaccine enhances the nervous necrosis virus infection resistance of fish bodies, reduces the death rate of the fish bodies infected with viruses, enhances humoral immunity of the fish bodies caused by the vaccine, causes all-around immune response of the fish bodies, and provides a good immune protection effect for the fish bodies.

Description

technical field [0001] The invention belongs to the technical field of fish immunology, and in particular relates to a fish bicistronic DNA vaccine. Background technique [0002] Viral neuronecrosis (VNN), also known as retinopathy and viral encephalopathy (viral encephalopathy and retinopathy, VER), is listed as an important fish disease by the World Organization for Animal Health (OIE), and is a worldwide epidemic. The pathogen of the disease belongs to the Nodaviridae family (Nodaviridae), β-Nodavirus (Betanodavirus), the virus mainly infects the nervous system of aquatic animals, causing viral nerve necrosis, so the virus is also called nerve necrosis virus ( Nervous necrosis virus, NNV). The structure of NNV is an icosahedron without envelope, with a diameter of about 20-30nm, and the genome consists of two single-stranded positive-strand RNAs. Among them, RNA1 encodes the RNA polymerase required for virus replication; RNA2 encodes the viral capsid protein (CP), which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/40C12N15/12A61K39/12A61P31/14A61P25/00
CPCC12N15/85C07K14/005C07K14/461A61K39/12A61P31/14A61P25/00C12N2800/107C12N2830/20C12N2770/30022C12N2770/30034A61K2039/53A61K2039/552
Inventor 邢婧林天雯战文斌唐小千绳秀珍迟恒
Owner OCEAN UNIV OF CHINA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More