Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for increasing yield of sialic acid and application

A sialic acid and amino acid technology, applied in the fields of enzyme engineering and microbial engineering, can solve the problems of low sialic acid yield, low N-acetylglucosamine-2-epimerase catalytic efficiency, etc.

Active Publication Date: 2021-09-03
JIANGNAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to solve the problems of low sialic acid yield and low catalytic efficiency of N-acetylglucosamine-2-epimerase in the prior art, the N-acetylglucosamine-2-epimerase is molecularly Transformation to improve its catalytic efficiency, by highly expressing N-acetylglucosamine-2-epimerase mutant and N-acetylneuraminic acid aldolase with high catalytic activity in recombinant Escherichia coli, and using the whole strain Cells efficiently synthesize sialic acid Neu5Ac, promoting its application in food, medicine and other fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing yield of sialic acid and application
  • Method for increasing yield of sialic acid and application
  • Method for increasing yield of sialic acid and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Construction of recombinant bacteria containing N-acetylglucosamine-2-epimerase mutant

[0049] The specific method is as follows:

[0050] (1) Chemically synthesize a gene encoding N-acetylglucosamine-2-epimerase whose nucleotide sequence is shown in SEQ ID NO.3;

[0051] (2) Use Extaq enzyme to amplify the N-acetylglucosamine-2-epimerase gene, connect it to the T vector, transform Escherichia coli JM109, screen to obtain recombinant bacteria, and extract to obtain N-acetylglucosamine-2-containing - T vector for the epimerase gene.

[0052] (3) Utilize the primer sequence, take the T carrier containing N-acetylglucosamine-2-epimerase gene as template PCR, carry out site-directed mutation at N-acetylglucosamine-2-epimerase gene; The primer sequences involved are as follows:

[0053] G371C-FW:AAATGGAAATGTTGCTTCCAC;

[0054] G371C-RS: TGGAAGCAACATTTCCATTT;

[0055] G371A-FW:AAATGGAAAGCTTGCTTCCAC;

[0056] G371A-RS: GTGGAAGCAAGCTTTCCATTT.

[0057] PCR rea...

Embodiment 2

[0063] Example 2: Expression, purification and analysis of N-acetylglucosamine-2-epimerase

[0064] Specific steps are as follows:

[0065] (1) Pick single colonies of E.coli BL21(DE3) / pET28a-G371C, E.coli BL21(DE3) / pET28a-G371A and E.coli BL21(DE3) / pET28a-WT prepared in Example 1 Inoculate to 50 μg·mL -1 Kanamycin liquid LB medium, 37°C, 200r min -1 After culturing for 12 hours, the seed solution was prepared.

[0066] (2) Inoculate the prepared seed liquid into LB liquid medium with an inoculation volume of 1% by volume, at 37°C, 200r min -1 Continue to culture to OD 600 When it is 0.8, add 1.0mmol·L -1 IPTG was cultured at 28°C for 8 hours to induce the expression of recombinant protein, and the crude enzyme solutions containing N-acetylglucosamine-2-epimerase mutants were obtained respectively: namely, the crude enzyme solutions containing G371A and the crude enzyme solutions containing G371C were respectively obtained , and a crude enzyme solution containing N-acety...

Embodiment 3

[0086] Embodiment 3: the preparation of sialic acid

[0087] Specific steps are as follows:

[0088] 1. Construction of recombinant Escherichia coli

[0089] (1) Chemically synthesize the nucleotide sequence of the N-acetylneuraminic acid aldolase gene shnal shown in SEQ ID NO.8, add NdeI and EcoRI restriction sites at both ends, and insert it into the vector plasmid pET28a after synthesis Between the cloning sites EcoRI and NdeI, the recombinant plasmid pET28a-shnal was obtained.

[0090] (2) The N-acetylglucosamine-2-epimerase mutant G371C gene and G371A gene and nucleotide sequence obtained in the step (4) of Example 2 are shown in SEQ ID NO.3 respectively N-acetylglucosamine-2-epimerase WT was digested by restriction enzymes NdeI and EcoRI and connected to the recombinant plasmid pET28a-shnal prepared in step (1) to obtain recombinant plasmids pET28a-shnal respectively. shnal-G371C, pET28a-shnal-G371A and pET28a-shnal-WT.

[0091] (3) Construction of recombinant Escher...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing the yield of sialic acid and an application, and belongs to the field of enzyme engineering and microbial engineering. According to the invention, the enzyme catalytic activity key amino acid site Gly371 of N-acetylglucosamine-2-epimerase is subjected to saturated mutation, and an enzyme mutant capable of improving the catalytic efficiency is screened. Through overexpression of the N-acetyl glucosamine-2-epimerase mutant and the N-acetylneuraminic acid aldolase with improved catalytic efficiency, the production efficiency of the recombinant escherichia coli for catalytic production of sialic acid is improved. The yields of Neu5Ac prepared by whole-cell catalysis of the recombinant escherichia coli containing G371C and the recombinant escherichia coli containing G371A, which are constructed by the invention, are respectively 352.0 and 353.6 mmol.L <-1 >, which are obviously higher than those of wild recombinant bacteria. Besides, the conversion efficiency of the Neu5Ac generated by converting GlcNAc under catalysis of a recombinant strain containing a mutant is obviously higher than that of a control strain.

Description

technical field [0001] The invention relates to a method and application for increasing the yield of sialic acid, belonging to the fields of enzyme engineering and microbial engineering. Background technique [0002] So far, among more than 50 kinds of sialic acids discovered, Neu5Ac (N-acetylneuraminic acid) is the most important one, and its content accounts for more than 99% of all sialic acids. Neu5Ac is the main species of sialic acid, which is mainly located at the end of non-reducing oligosaccharides such as glycoproteins or glycolipids in the form of α-glycosides. Neu5Ac is an acidic amino sugar. Neu5Ac is easily soluble in water and slightly soluble in methanol. It is very stable in aqueous solution and can be stored for a long time, but its stability will be greatly affected in acidic or alkaline solutions. influences. Neu5Ac has broad application prospects in the fields of food, medicine and rapid detection of diseases. Neu5Ac can regulate the anti-inflammatory...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/90C12N9/88C12N15/61C12N15/70C12N1/21C12P19/26C12R1/19
CPCC12N9/90C12N9/88C12N15/70C12P19/26C12Y501/03014C12Y401/03003
Inventor 陈献忠杨海泉沈微周俊波
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com