Application of chemical modification CRISPR/Cpf1 compound

A chemical modification and complex technology, applied in the field of gene editing, can solve the problems of off-target, low efficiency of CAR-T cell preparation, long expression peak, etc.

Active Publication Date: 2021-09-07
PEKING UNIV
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Usually, CRISPR is used to edit the genes of T cells in vitro by introducing DNA or mRNA into the cells for editing, and then realize the preparation of CAR-T cells by introducing exogenous donor DNA or delivering donors through AAV. DNA delivery editing has potential The risk of integration and its continuous expression may increase the off-target efficiency. The mRNA delivery editing method also has the adverse effect of longer expression peak and easy to increase off-target. Compared with this, the direct delivery of ribonucleoprotein complex (RNP) directly combines protein and RNA introduced into cells that can quickly respond to cleavage and rapidly degrade proteins after editing is the safest gene editing delivery method known so far, and its off-target editing efficiency is significantly lower than other delivery methods, so it is widely used in CAR- Preparation of T cells
The use of CRISPR-Cpf1-based mRNA delivery system has been reported. Through systematic optimization, the preparation of CAR-T targeting TRAC gene and the preparation of multiple gene knockout CAR-T can be realized. The preparation by RNP is a more optimal method. However, there is no related method reported in the literature
The reason is that the overall gene editing efficiency of Cpf1 is not ideal, and the preparation efficiency of CAR-T cells using the RNP complex of Cpf1-crRNA is very low, which greatly limits its wide application in the preparation of immune cell CAR-T. There is an urgent need to provide a method for efficiently preparing CAR-T cells by using improved Cpf1 to deliver through RNP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of chemical modification CRISPR/Cpf1 compound
  • Application of chemical modification CRISPR/Cpf1 compound
  • Application of chemical modification CRISPR/Cpf1 compound

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0052] In the embodiments of the present invention, a gene editing method is provided. In this method, a chemically modified CRISPR / Cpf1 complex is first prepared. The preparation method of the complex comprises: (1) expressing Cpf1 protein containing unnatural amino acid by gene codon extension technology; (2) coupling Cpf1 protein containing modified crRNA and unnatural amino acid at 5' end through orthogonal reaction couplet. The complex is then used to edit the cell.

[0053] In the gene editing method of the present invention, the gene editing method mediated by adeno-associated virus vector, the gene editing method mediated by lentivirus vector, the gene editing method mediated by adenovirus are also combined, or a plasmid vector or a single-stranded / Double-stranded DNA is introduced into the target gene. Alternatively, RNA interference technology can also be combined to reduce or silence the expression of the target gene. For example, in the embodiment of the prese...

Embodiment 1

[0066] Example 1: Construction of a gene vector comprising site-directed mutation AsCpf1

[0067] (1) Acquisition of helper plasmids

[0068] pUltra-MjPolyRS (purchased from Addgene) (hereinafter referred to as the helper plasmid), which can express tRNA and tRNA synthetase for specifically recognizing and inserting the unnatural amino acid AeF.

[0069] (2) Acquisition of AsCpf1 plasmid

[0070] The protein sequence in the pET22b-AsCpf1 plasmid was obtained by PCR from Addgene plasmid #102565, and then PCR primers were used to introduce enzyme-cut 5'NdeI and 3'XhoI at the end, and the complete plasmid sequence was constructed by enzyme-cut ligation, which can be used in Escherichia coli Recombinant expression of AsCpf1 protein in bacteria.

[0071] The primer sequences used are shown in Table 1:

[0072] Table 1

[0073] Primer name Primer sequence (5'-3') Cpf1-2NLS-FW gggaattgtgagcggataacaattcccc SV40-RV cccactttacgtttctttttaggactgccctttttcttttt...

Embodiment 2

[0082] Example 2: Expression, purification and in vitro activity verification of chemically modified Cpf1 (AzCpf1)

[0083] 1: The amino acid is synthesized by the inventor

[0084] Synthetic route see figure 1 , and the synthetic steps were operated with reference to the literature.

[0085] 2: Chemically modify the expression of Cpf1 (AzCpf1) protein

[0086] The expression strain BL21-pET22b-AsCpf1-M806TAG obtained in step (4) of Example 1 was cultured overnight in a 2YT medium (containing spectinomycin and ampicillin) at 37° C. and 220 rpm in a constant temperature shaker. The next day, inoculate into fresh 2YT medium (containing spectinomycin and ampicillin) at a ratio of 1:100, culture in a constant temperature shaker at 37°C and 220 rpm, and add 1 mM AeF amino acid to continue to Cultivate, and when the OD value is 0.6-1.0, add 0.2mMIPTG (Isopropylβ-D-1-thiogalactopyranoside), and induce the expression of 16- Bacteria were collected after 18 hours. The positive con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene editing, and particularly relates to application of a chemical modification CRISPR / Cpf1 compound. The invention discloses application of the CRISPR / Cpf1 compound in cell gene editing. In the compound, chemical modification Cpf1 protein is coupled with crRNA and is marked as cCpf1. The compound is used for gene editing, so that the gene editing efficiency can be improved. When the compound is applied to the preparation of immune cells, the preparation efficiency of CAR-T can be improved; more importantly, the preparation efficiency of multi-site gene editing and universal CAR-T can be improved.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to the use of chemically modifying the CRISPR / Cpf1 complex. Background technique [0002] Tumor is a major disease that plagues human health. Due to the high complexity, diversity and variability of the biological characteristics of tumors, it has become a huge challenge for scientists to understand the mechanism of tumor occurrence and development and find ways to treat tumors. In recent years, with the deepening understanding of the relationship between tumors and hosts, especially the body's anti-tumor immune response and tumor immune escape mechanism, the application of intervention methods based on immune cells, molecules, and genes to tumor treatment has become a concern of scientists. A major hotspot and achieved exciting clinical trial results. Tumor immunotherapy has become the fourth type of anti-tumor therapy that has been proven to have significant clinical therap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/87C12N15/864C12N5/10A61K48/00A61K35/17A61P35/00A61P37/02
CPCC12N15/87C12N15/86C07K16/2803C07K14/7051C12N5/0656C12N5/0686C12N5/0694C12N5/0636C12N5/0646C12N5/0645A61K48/005A61K48/0008A61K35/17A61P35/00A61P37/02C12N2750/14143C12N2800/107C07K2319/33C12N2510/00
Inventor刘涛凌鑫宇常丽颖
OwnerPEKING UNIV