Unlock instant, AI-driven research and patent intelligence for your innovation.

Copper-containing amine oxidase sourced from saccharopolyspora cavaleriei and capable of degrading biogenic amine and application thereof

A copper amine oxidase and recombinant microorganism technology, applied in the field of molecular biology, can solve the problem of high biogenic amine content, achieve the effects of wide degradation spectrum and improved safety

Active Publication Date: 2021-09-17
JIANGNAN UNIV +2
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem of high biogenic amine content in existing traditional fermented foods, to provide a copper-containing amine oxidase derived from Saccharopolyspora sp. amine method to reduce biogenic amines in rice wine, soy sauce and other fermented foods, and improve the quality of traditional fermented foods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Copper-containing amine oxidase sourced from saccharopolyspora cavaleriei and capable of degrading biogenic amine and application thereof
  • Copper-containing amine oxidase sourced from saccharopolyspora cavaleriei and capable of degrading biogenic amine and application thereof
  • Copper-containing amine oxidase sourced from saccharopolyspora cavaleriei and capable of degrading biogenic amine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: PCR amplification of the copper-containing amine oxidase gene in S.hirsuta J2

[0047] Primers were designed according to the amine oxidase gene (Protein ID is WP_150069050.1) in Saccharopolyspora hirsuta (Saccharopolyspora hirsuta) in the NCBI database, and the S.hirsuta J2 (preservation number: CCTCC NO: M 2020103, disclosed in the patent application document with publication number CN111961615A) the genome is used as a template to amplify the multi-copper oxidase gene. The primers required for amplification are as follows: the upper primer sequence (5'→3') is ATGATGGCGATGCACCCGCTGG; the lower primer sequence (5'→3') is TCAGGACTCGCAGCAGTGGG. according to Requirements for the reaction system of HS DNA Polymerase with GC Buffer Configure the PCR reaction solution. The PCR amplification system is as follows: pre-denaturation at 98°C for 10s, annealing at 55°C for 30s, extension at 72°C (1min·kb -1 ) cycle 30 times.

[0048] Using the genome of S.hirsuta J2...

Embodiment 2

[0049] Example 2: Genetically engineered bacteria E.coli BL21-pET28a-CuAO Shir build

[0050] (1) Obtain the target fragment.

[0051] Using the whole genome sequence of S. hirsuta J2 as a template, the primers and the whole genome DNA are used to complete PCR amplification. The PCR reaction system and amplification procedure are the same as those described in Example 1, and the correct PCR product gel is carefully cut for band verification. , recovered and purified.

[0052] (2) Digestion and ligation.

[0053] The plasmid pET-28a(+) and the target fragment were double-digested with restriction endonuclease Nde I and EcoR I respectively. The restriction enzyme digestion system was as follows: 40 μL of target gene fragment, 40 μL of plasmid, I and EcoR I each 2.5 μL, Green Buffer 5 μL. The components in the enzymatic cleavage system were thoroughly mixed, and then placed in a metal bath at 37°C for 45 minutes of reaction. After recovery and purification, the double-digest...

Embodiment 3

[0058] Embodiment 3: Recombinase CuAO Shir induced expression and purification

[0059] (1) Recombinase CuAO Shir induced expression of

[0060] The recombinant bacterium constructed in Example 2 was inoculated to contain 50 mg·L -1 In LB medium of ampicillin, at 37°C, 150r·min -1 Conditioned for 12h. The seed solution was transferred to the seed solution containing 50mg·L -1 In the TB fermentation medium of kanamycin, at 37°C, 160r·min -1 Grow to OD 600 is 0.6, and the final concentration is 0.25mmol L -1 IPTG, at 25°C, 160r·min -1 After culturing for 12 hours under the same conditions, the bacterial solution OD 600 is 1.5. Bacterial liquid at 4 ℃, 12000r min -1 Under these conditions, after centrifugation for 10 min, the lower layer of bacteria was collected, and 0.2 mol·L -1 The cells were resuspended in sodium phosphate buffer (pH 7.4) and collected by centrifugation, and the above steps were repeated twice. Use an ultrasonic cell disruptor to crush the bacter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Specific vitalityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a copper-containing amine oxidase sourced from saccharopolyspora cavaleriei and capable of degrading biogenic amine and application thereof, and belongs to the technical field of molecular biology. The copper-containing amine oxidase is screened from saccharopolyspora cavaleriei, has relatively strong biogenic amine degradation performance, is wide in degradation spectrum and has certain tolerance to ethanol, the total biogenic amine degradation rates of commercially available yellow rice wine and commercially available soy sauce are 30.25% and 18.29% respectively, the copper-containing amine oxidase has certain application value in fermented wine such as yellow rice wine and grape wine, and the safety of the fermented food can be further improved.

Description

technical field [0001] The invention relates to a copper-containing amine oxidase derived from Saccharopolyspora emanatus and capable of degrading biogenic amines and an application thereof, belonging to the technical field of molecular biology. Background technique [0002] Biogenic amines are low-molecular-weight, nitrogen-containing organic bases mainly formed by the decarboxylation of amino acids. Biogenic amines are widely distributed in nature, can be metabolized by microorganisms, plants and animals, and can be ingested into the human body through food. An appropriate amount of biogenic amines has positive effects on the human body, such as improving human immunity, enhancing blood vessel activity, and regulating mental activity. However, when biogenic amines accumulate in the human body in large quantities, they can cause different toxic effects, such as headache, hypotension, heart palpitations and vomiting, and even life-threatening in severe cases. The biogenic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/06C12N15/53C12N15/70C12N1/21C12R1/19
CPCC12N9/0022C12N15/70C12Y104/03006
Inventor 毛健刘双平孙梦菲徐岳正钱斌
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More