Anti-tumor polypeptide Bax-BH3, fluorescent polymer nano-micelle as well as preparation method and application of fluorescent polymer nano-micelle
A nanomicelle, bax-bh3 technology, applied in the field of medicine, can solve the problems of difficult tumor cell uptake, easy to be degraded, short cycle time, etc., to achieve good biological activity, high encapsulation efficiency and drug loading capacity, good release performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0058] The present invention also provides a preparation method of the fluorescent polymer nanomicelle, comprising the following steps: 1) dissolving the block copolymer RGD-PHPMA-b-Poly (MMA-alt-(Rhob-MA)) in organic Obtain a block copolymer solution in a solvent; 2) Dissolve the anti-tumor polypeptide Bax-BH3 in water to obtain a polypeptide solution; 3) Add the block copolymer solution dropwise to the polypeptide solution to obtain a fluorescent polymer nano Micelles; no chronological order between steps 1) and 2).
[0059] In the present invention, the block copolymer RGD-PHPMA-b-Poly (MMA-alt-(Rhob-MA)) is dissolved in an organic solvent to obtain a block copolymer solution. In the present invention, the concentration of the block copolymer solution is preferably 2 to 3 mg / mL, more preferably 2.2 to 2.8 mg / mL, most preferably 2.5 mg / mL; in the present invention, the organic solvent is preferably to tetrahydrofuran.
[0060] In the present invention, the anti-tumor polyp...
Embodiment 1
[0065] Synthesis of target gene fragments
[0066] The target gene fragment was synthesized by Jilin Province Kumei Biotechnology Co., Ltd., and its sequence is as follows:
[0067] ATGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCCGGCGAATTGGAGATGAACTGGACAGC (SEQ ID No. 2).
[0068] The primers containing EcoR I and Xho I are designed according to the target gene sequence as follows: the upstream primer sequence 5'-CCGCTCGAGATGGATGCGTCCACCAAGAAG-3' (SEQ ID No.3), contains the Xho I site (bold); the downstream primer sequence 5' -CCGGAATTCGCTGTCCAGTTCATCTCC-3' (SEQ ID No.4), containing the EcoR I site (bold), the primer was synthesized by Jilin Province Kumei Biotechnology Co., Ltd. Using the synthesized target gene as a template, PCR amplification was carried out, and the reaction conditions are shown in Table 1.
[0069] Double enzyme digestion of target gene and pLVX-mCherry-N1 expression vector
[0070] The target gene and pLVX-mCherry-N1 (purchased from genewiz Jinweizhi Biotechnolo...
Embodiment 2
[0085] A Combination Method of Fluorescent Polymer Nanomicelle Coated Bax-BH3 Peptide
[0086] Such as Figure 5 As shown, in this embodiment, PHPMA (polymethyl methacrylate) is used as the hydrophilic end, PMMA (polymethyl methacrylate) is used as the hydrophobic end, Rhodamine B is used as the fluorescent marker, and RGD is used as the targeting peptide ( RGD peptide was purchased from Jill Biochemical Shanghai Co., Ltd.), and a fluorescent co-block polymer micelle with one end hydrophilic and one end hydrophobic was synthesized, and Bax-BH3 peptide (Bax-BH3 peptide (Bax- BH3 peptide was synthesized by Jill Biochemical Shanghai Co., Ltd.).
[0087] Such as Figure 6 As shown, the modified rhodamine B and MMA are used as the hydrophobic end repeating unit, and the hydrophobic end Poly(MMA-alt-(Rhob-MA)) is synthesized by RAFT reaction, and then polymerized with HPMA to synthesize a hydrophilic end and a hydrophobic end. Chain co-block polymer PHPMA-b-Poly (MMA-alt-(Rhob-MA...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| concentration | aaaaa | aaaaa |
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More