Supercharge Your Innovation With Domain-Expert AI Agents!

Leiocassis longirostris male sex specific molecular marker and amplification primer and genetic sex identification method thereof

A technology of molecular markers and identification methods, applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., to achieve the effect of less damage and solving difficult identification

Active Publication Date: 2021-12-31
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI +1
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the molecular markers related to the sex identification of long-snouted catfish.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leiocassis longirostris male sex specific molecular marker and amplification primer and genetic sex identification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Acquisition of male-specific molecular markers of Long-snout Catfish

[0027] Bouin's fixative was used to fix the gonad tissue of S. longissima, and the sex of S. longissima was identified by paraffin section and HE staining. Genomic DNA from the blood of 16 male and female scorpionfish was extracted, a sequencing library was constructed, sequenced by an Illumina sequencer, and the whole genome sequencing data of male and female scorpionfish were obtained, and male sex-specific DNA fragments were obtained by comparative genomics analysis. Based on this sequence design Corresponding primers were validated by the population to prove their effectiveness, and finally a sex-specific molecular marker for the male sex-specific molecular marker of S. longissimus with the nucleotide sequence shown in SEQ ID No.1 was obtained.

Embodiment 2

[0028] Example 2: Application of Specific Molecular Markers for Sex Identification of Long-snout Catfish

[0029] 1. Design primers for the molecular marker whose nucleotide sequence is shown in SEQ ID No.1 in Example 1:

[0030] F: TAGGTTGATGACCCGCGACTGTCT (SEQ ID No. 2);

[0031] R: TGTGGGAATGTTTTAAGAATCCTTAC (SEQ ID No. 3).

[0032] 2. PCR amplification:

[0033] Extract the genomic DNA of the long-snout catfish as a template, and use the primers for PCR amplification;

[0034] The reaction system is: about 50 ng of template DNA; 10 μl of 2×EasyTaq® PCR SuperMix; 0.4 μl of upstream and downstream primers with a concentration of 10 μM; supplemented with ddH 2 0 to 20 μl.

[0035] The PCR reaction program used was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 20 s, 34 cycles; final extension at 72°C for 10 min.

[0036] 3. Electrophoresis detection:

[0037] A 1.5% agarose gel was prepared, and afte...

Embodiment 3

[0038] Example 3: Verification of the application of male sex-specific molecular markers in long-snout catfish sex identification

[0039] 1. Collect 12 male and female individuals of known gender, and store the fin ray samples in absolute ethanol. Use the DNA extraction kit to extract the genomic DNA, measure the concentration and dilute to 50 ng / μl, and store in Standby at -20°C.

[0040] 2. Using the long-breasted catfish genomic DNA in step 1 as a template, use the primers in Example 2 to perform PCR amplification. The reaction system and PCR reaction procedure are the same as in Example 2, and the obtained PCR products are detected by electrophoresis.

[0041] 3. For the amplification results, see figure 1 , where M is the DL2000 DNA marker, N is the negative control, the left lanes 1-12 are female individuals, no specific target bands are amplified, and the right lanes 13-24 are male individuals, all of which can amplify the size It is the specific target band of 501b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a leiocassis longirostris male sex specific molecular marker and an amplification primer and a genetic sex identification method thereof. The nucleotide sequence of the leiocassis longirostris male specific molecular marker is as shown in SEQ ID No. 1, and the nucleotide sequences of the amplification primers of the leiocassis longirostris male specific molecular marker are as shown in SEQ ID No. 2 and SEQ ID No. 3. The leiocassis longirostris genomic DNA is subjected to PCR amplification by using the amplification primers, the product is subjected to electrophoresis detection, if a specific band is amplified, the leiocassis longirostris is identified as a male individual, and if a specific target band is not amplified, the leiocassis longirostris is identified as a female individual, and the genetic sex identification method is simple, rapid, direct, high in accuracy rate, small in damage to the leiocassis longirostris, the method is not limited by the development period of the leiocassis longirostris, solves the problem of difficulty in sex identification in the early development period of the leiocassis longirostris, and has important significance for realizing sex control breeding of the leiocassis longirostris in production.

Description

technical field [0001] The invention belongs to the technical field of DNA molecular markers, and in particular relates to a male sex-specific molecular marker, an amplification primer, and a genetic sex identification method thereof. Background technique [0002] Long snout ( Leiocassis longirostris Gunther) belongs to the genus Siluriformes, Oleidae, and genus, commonly known as Jiangtuan and Feituo. Because its snout is longer than that of ordinary fish, the scientific name is long-snouted Snout. Long-snouted catfish is mainly distributed in the main and tributaries of the Yangtze River and large river-connected lakes. It is a rare and valuable freshwater economic fish. Its meat is tender and delicious, without intermuscular spines and has a high meat content. Eat jiangtuan, don't know the taste of fish". Due to many factors such as environmental deterioration, sharp decline in resources, and artificial fishing, the resources of wild scorpionfish in my country have dec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6879C12Q1/686C12N15/11
CPCC12Q1/6888C12Q1/6879C12Q1/686C12Q2565/125
Inventor 叶欢阮瑞李创举岳华梅宋信华
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More