Leiocassis longirostris male sex specific molecular marker and amplification primer and genetic sex identification method thereof
A technology of molecular markers and identification methods, applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., to achieve the effect of less damage and solving difficult identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Acquisition of male-specific molecular markers of Long-snout Catfish
[0027] Bouin's fixative was used to fix the gonad tissue of S. longissima, and the sex of S. longissima was identified by paraffin section and HE staining. Genomic DNA from the blood of 16 male and female scorpionfish was extracted, a sequencing library was constructed, sequenced by an Illumina sequencer, and the whole genome sequencing data of male and female scorpionfish were obtained, and male sex-specific DNA fragments were obtained by comparative genomics analysis. Based on this sequence design Corresponding primers were validated by the population to prove their effectiveness, and finally a sex-specific molecular marker for the male sex-specific molecular marker of S. longissimus with the nucleotide sequence shown in SEQ ID No.1 was obtained.
Embodiment 2
[0028] Example 2: Application of Specific Molecular Markers for Sex Identification of Long-snout Catfish
[0029] 1. Design primers for the molecular marker whose nucleotide sequence is shown in SEQ ID No.1 in Example 1:
[0030] F: TAGGTTGATGACCCGCGACTGTCT (SEQ ID No. 2);
[0031] R: TGTGGGAATGTTTTAAGAATCCTTAC (SEQ ID No. 3).
[0032] 2. PCR amplification:
[0033] Extract the genomic DNA of the long-snout catfish as a template, and use the primers for PCR amplification;
[0034] The reaction system is: about 50 ng of template DNA; 10 μl of 2×EasyTaq® PCR SuperMix; 0.4 μl of upstream and downstream primers with a concentration of 10 μM; supplemented with ddH 2 0 to 20 μl.
[0035] The PCR reaction program used was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 20 s, 34 cycles; final extension at 72°C for 10 min.
[0036] 3. Electrophoresis detection:
[0037] A 1.5% agarose gel was prepared, and afte...
Embodiment 3
[0038] Example 3: Verification of the application of male sex-specific molecular markers in long-snout catfish sex identification
[0039] 1. Collect 12 male and female individuals of known gender, and store the fin ray samples in absolute ethanol. Use the DNA extraction kit to extract the genomic DNA, measure the concentration and dilute to 50 ng / μl, and store in Standby at -20°C.
[0040] 2. Using the long-breasted catfish genomic DNA in step 1 as a template, use the primers in Example 2 to perform PCR amplification. The reaction system and PCR reaction procedure are the same as in Example 2, and the obtained PCR products are detected by electrophoresis.
[0041] 3. For the amplification results, see figure 1 , where M is the DL2000 DNA marker, N is the negative control, the left lanes 1-12 are female individuals, no specific target bands are amplified, and the right lanes 13-24 are male individuals, all of which can amplify the size It is the specific target band of 501b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
