Application of SlLYK4 gene in enhancing resistance to tomato fungal diseases
A fungal and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Amplification of the full length of the SlLYK4 gene in tomato.
[0031] Search in the "https: / / solgenomics.net / search / locus" website to obtain the sequence of the SlLYK4 gene (the search number of the SlLYK4 gene is Solyc02g089900), the nucleotide sequence of the protein coding region is shown in SEQ ID NO.1, the protein The amino acid sequence of the coding region is shown in SEQ ID NO.2. Refer to the Gateway manual to design the forward primer: 5’>ggggacaagtttgtacaaaaaagcag gctacATGAATTATTTCATCTCATCT>3’ and the reverse primer 5’>ggggaccactttgtacaa gaaagctggtcGGGCAATCTATGTGGTGACA>3’. The RNA of tomato leaves was extracted, cDNA was obtained by reverse transcription, and the full-length gene was amplified by the KOD high-fidelity enzyme method of TOYOBO Company. The PCR electrophoresis of cDNA amplification of SlLYK4 gene is shown figure 1 .
[0032] The PCR reaction system is as follows:
[0033] system volume sterile water 32μL 10XPCR Buffer...
Embodiment 2
[0036] Construction of SlLYK4 gene constitutive high expression (35S promoter) vector.
[0037] The full-length gene (nucleotide sequence shown in SEQ ID NO.1) was subjected to BP recombination reaction with the vector pDONR, and the ligated product was transformed into E. coli DH5α strain by heat shock method, and positive colonies were selected and added to 4 mL containing 100 mg / L Zeocin In the resistant LB liquid medium, culture at 37°C for 10-12 hours in a shaker at 200 rpm. A small amount of plasmid was extracted, and after enzyme digestion and PCR identification, it was sent to TSINGKE Biological Technology Company for sequence determination. Perform LR reaction between the correctly sequenced plasmid and pGWB5-GFP empty load, transform the ligated product into E. coli DH5α strain by heat shock method, select positive colonies and add them to 4 mL of LB liquid medium containing 100 mg / L resistance, at 37 ℃, 200rpm shaker for 10-12 hours. A small amount of plasmid was ...
Embodiment 3
[0039] The 35S::SlLYK4-GFP expression vector was transformed into tomato callus.
[0040] The successfully constructed 35S::SlLYK4-GFP vector was transformed into the Agrobacterium GV1301 strain by electric shock method, and the positive colonies were selected and added to 4 mL of LB containing 100 mg / L Kan (kanamycin) and Rif (rifampicin) resistance. In the liquid culture medium, culture at 28°C, 200rpm shaker for 10-12 hours. Send the bacterial liquid to Bioge Gene Technology (Jiangsu) Co., Ltd. to transfer the gene into the tomato callus by tomato tissue culture, and then screen the hygromycin-resistant callus, induce germination and induce rooting, etc. step yields T 0 transgenic plants.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More