Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for improving mechanical properties of paper by using glycosyl transferase promoter to drive GA20ox

A technology of glycosyltransferase and promoter, which is applied in the direction of plant genetic improvement, botanical equipment and methods, biochemical equipment and methods, etc., to achieve the effects of enhanced mechanical properties, great economic value, and improved fiber binding ability

Pending Publication Date: 2022-04-05
CHINESE ACAD OF FORESTRY +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no studies on how GA20ox genes affect wood component structure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving mechanical properties of paper by using glycosyl transferase promoter to drive GA20ox
  • Method for improving mechanical properties of paper by using glycosyl transferase promoter to drive GA20ox
  • Method for improving mechanical properties of paper by using glycosyl transferase promoter to drive GA20ox

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0023] The drugs involved in the test in this example were all purchased from Sigma Company, Fermentas Company, Thermo Fisher Company, and Shanghai Sangong Company.

[0024] 1. Molecular cloning of GA20ox gene

[0025] Total RNA was extracted from Arabidopsis thaliana stems, the full-length cDNA of GA20ox gene was amplified by RT-PCR technology, and sequenced (see SEQ ID No.1). Amplification conditions were: 5 min pre-denaturation at 95°C; 30 s at 94°C, 40 s at 55°C, 1 min at 72°C to complete 35 cycles; and 8 min at 72°C for fragment extension. The amplification primers are:

[0026] ArGA20F: TGCAGGATCC ATGGCCGTAAGTTTCGTAAC

[0027] ArGA20R:TGCAGAGCTCTTAGATGGGTTTGGTGAGCC

[0028] SEQ ID No. 1:

[0029] M13R:

[0030]

[0031]

[0032]

[0033] (a) Sequence features:

[0034] Length: 1134bp

[0035] Type: base sequence

[0036] Chain type: double chain

[0037] Topology: Linear

[0038] (b) Molecule type: DNA

[0039] (c) Assumption: No

[0040] (d) Antisen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
strengthaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for improving mechanical properties of paper by using a glycosyl transferase promoter to drive GA20ox. The glycosyl transferase 8D1 promoter specifically expressed by xylem is used for driving gibberellin oxidase GA20ox gene overexpression to change the characteristics of poplar wood nanocellulose; the method comprises the following steps: obtaining a recombinant vector which is over-expressed by a GA20ox gene driven by a promoter 8D1P which is specifically expressed in the xylem of a poplar stalk, and applying the recombinant vector to genetic transformation of the poplar to obtain an 8D1P: GA20ox transgenic poplar, and achieving the purpose of improving the characteristics of the wood nanocellulose; the wood nano-cellulose characteristic improvement of the transgenic poplar is embodied in that the diameter of the nano-cellulose is increased, the nano-cellulose is used as an additive to increase hydrogen bonds among fibers by increasing the specific surface area, and the binding capacity of the fibers is improved, so that the mechanical property of the paper is better enhanced. The diameter of the transgenic material nanocellulose is larger, the mechanical strength of paper fibers can be remarkably improved, and the change of the characteristics can be more beneficial to application of pulping and papermaking.

Description

technical field [0001] The invention relates to the field of improving pulping and papermaking properties, in particular to a method for improving mechanical properties of paper by using a glycosyltransferase promoter to drive GA20ox. Background technique [0002] Poplar is one of the important afforestation tree species widely cultivated in the world. It has the characteristics of wide distribution, fast growth, strong asexual reproduction ability, etc., coupled with its advantages of fast growth and high yield, clear genetic background, etc., and has been widely used as a research base for woody plant genetics. pattern system. my country is rich in poplar resources. In recent years, the area of ​​poplar afforestation in my country has continued to expand, and it has become the country with the largest planted forest area in the world. The clone 84K of Populus silver glandularis is widely used in pulp and papermaking because of its rapid growth at emergence, easy transform...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/113C12N15/53C12N9/02A01H5/00A01H6/00A01H4/00D21H17/25D21H21/52
Inventor 李全梓彭霄鹏佟博通黄雄
Owner CHINESE ACAD OF FORESTRY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More