Method for improving mechanical properties of paper by using glycosyl transferase promoter to drive GA20ox
A technology of glycosyltransferase and promoter, which is applied in the direction of plant genetic improvement, botanical equipment and methods, biochemical equipment and methods, etc., to achieve the effects of enhanced mechanical properties, great economic value, and improved fiber binding ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0023] The drugs involved in the test in this example were all purchased from Sigma Company, Fermentas Company, Thermo Fisher Company, and Shanghai Sangong Company.
[0024] 1. Molecular cloning of GA20ox gene
[0025] Total RNA was extracted from Arabidopsis thaliana stems, the full-length cDNA of GA20ox gene was amplified by RT-PCR technology, and sequenced (see SEQ ID No.1). Amplification conditions were: 5 min pre-denaturation at 95°C; 30 s at 94°C, 40 s at 55°C, 1 min at 72°C to complete 35 cycles; and 8 min at 72°C for fragment extension. The amplification primers are:
[0026] ArGA20F: TGCAGGATCC ATGGCCGTAAGTTTCGTAAC
[0027] ArGA20R:TGCAGAGCTCTTAGATGGGTTTGGTGAGCC
[0028] SEQ ID No. 1:
[0029] M13R:
[0030]
[0031]
[0032]
[0033] (a) Sequence features:
[0034] Length: 1134bp
[0035] Type: base sequence
[0036] Chain type: double chain
[0037] Topology: Linear
[0038] (b) Molecule type: DNA
[0039] (c) Assumption: No
[0040] (d) Antisen...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
strength | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap