Recombinant chicken interleukin-9 protein and preparation and application of antibody of recombinant chicken interleukin-9 protein

A protein and cell technology, applied in the direction of interleukin, anti-cytokine/lymphokine/interferon immunoglobulin, cytokine/lymphokine/interferon, etc., can solve the problem of unclear molecular weight of chicken IL-9 , to achieve the effect of easy mass production

Pending Publication Date: 2022-04-19
YANGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the lack of corresponding detection tools, the true molecular weight of natural chicken IL-9 is not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant chicken interleukin-9 protein and preparation and application of antibody of recombinant chicken interleukin-9 protein
  • Recombinant chicken interleukin-9 protein and preparation and application of antibody of recombinant chicken interleukin-9 protein
  • Recombinant chicken interleukin-9 protein and preparation and application of antibody of recombinant chicken interleukin-9 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1c

[0033] Embodiment 1 chIL-9 recombinant protein preparation

[0034] 1. ChIL-9 prokaryotic protein expression

[0035] Because chicken gene codons have low adaptability to Escherichia coli hosts, the cloned chIL-9 nucleotide sequence (as shown in SEQ ID NO.1) without signal peptide was first optimized to be used more frequently in Escherichia coli. a. PCR primers were designed using Primer5.0 software, and restriction sites BamH Ⅰ and Xho Ⅰ and tev protease cleavage sites were introduced for RT-PCR amplification and cloned into the prokaryotic expression vector pET-32a ( figure 1 ), and finally transformed into ROSETTA expression host bacteria.

[0036] PCR primer sequence (shown in SEQ ID NO.5 and 6):

[0037] F:5'-CGGGATCC(BamHI)GAGAACCTGTACTTCCAAGGG(tev)CAGAATTGCCAGGTT-3'

[0038] R: 5'-CCGCTCGAG(XhoI)TCACACGCGGCTTTTAT-3'.

[0039] After the recombinant plasmid containing the target gene was transformed into ROSETTA host bacteria, it was induced by a small amount of IPT...

Embodiment 2c

[0046] The biological function of embodiment 2chIL-9 recombinant protein

[0047] 1. Activation of chIL-9 recombinant eukaryotic protein on chicken macrophages

[0048] In this experiment, chicken HD11 macrophage cell line and chicken peripheral blood mononuclear cells adhered primary macrophages were selected to detect the function of chIL-9 recombinant protein. The supernatant of pEGFP-C plasmid transfection was added to the control group, the supernatant of pEGFP-C-chIL-9 plasmid transfection was added to the chIL-9 group, and the LPS group was used as a positive control; RNA was extracted after 6 hours of treatment, reverse transcribed into cDNA, and detected by qPCR Changes of key macrophage activating factors IL-1β, IL-6 and iNOS. Figure 5 The results showed that recombinant eukaryotic chIL-9 could activate chicken macrophages to produce inflammatory cytokines.

[0049] 2. The effect of chIL-9 recombinant protein on the proliferation of chicken T cells

[0050] In th...

Embodiment 3c

[0051] Example 3 Preparation of chIL-9 mouse monoclonal antibody

[0052] The main steps of monoclonal antibody preparation include: mouse immunization, cell fusion, screening of hybridoma cells, cell monocloning, antibody identification, ascites preparation and purification.

[0053] 1. Screening of positive hybridoma cells

[0054] 6-week-old female BALB / c mice were selected, and 40 μg of prokaryotically expressed chIL-9 was mixed and emulsified with Freund's adjuvant. Mice were immunized three times by intraperitoneal injection, with an interval of two weeks between each immunization. After 7 days, blood was collected from the tail vein to measure the titer, and the immunization was strengthened. Three days later, the splenocytes of the mice were fused with SP2 / 0 cells under the action of 50% PEG-1500 , and added to feeder cells containing HAT medium, placed at 37 ° C, 5% CO 2 in the cell culture incubator. After 5 days, half of the medium was changed, and after 10 days,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Cell numberaaaaaaaaaa
Login to View More

Abstract

The invention relates to preparation and application of a recombinant chicken interleukin-9 protein and an antibody of the recombinant chicken interleukin-9 protein, and aims at solving the technical problems of preparing recombinant chicken IL-9 prokaryotic protein and eukaryotic protein with biological functions and measuring the biological activity of the recombinant chicken IL-9 prokaryotic protein and eukaryotic protein. The technical problem to be solved by the invention is to prepare monoclonal and polyclonal antibodies for detecting chicken IL-9. And the antibodies are used for realizing detection of natural IL-9 protein expressed by immune cells in a chicken body. According to the invention, the problem of difficult recombinant expression of chicken IL-9 cell factors is successfully solved, and the recombinant chicken IL-9 protein has biological activity of activating chicken macrophages and promoting chicken T cell proliferation, which indicates that the recombinant chicken IL-9 protein has an immunological enhancement function. The chicken IL-9 protein and the antibody provided by the invention are easy for mass production, and are convenient for later application in basic research of poultry industry and poultry immunology.

Description

technical field [0001] The invention relates to the preparation and application of a recombinant chicken interleukin-9 protein and its antibody, in particular to the expression of recombinant protein, the preparation and application of monoclonal and polyclonal antibodies, and belongs to the field of poultry immunology, biological products and diagnostic reagents . Background technique [0002] Interleukin-9 (IL-9) is a pleiotropic cytokine that belongs to the γ-chain receptor cytokine family with IL-2, IL-4, IL-7, IL-15 and IL-21[ 1]. IL-9 was originally discovered as a growth factor secreted by Th2 T cells, but was later found to be mainly secreted by Th9 T cells[2,3]; in addition, Th17, regulatory T cells, CD8 + T cells, natural killer cells, mast cells and innate lymphoid cells can secrete IL-9[4]. IL-9 can act on mast cells, B cells, T cells, hematopoietic progenitor cells, macrophages, DC cells, etc. [5]. Although the chicken IL-9 gene has been annotated in the who...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/54C12N15/70C12N15/85C12N15/24A61K38/20A61K39/39A61P37/04C07K16/24C07K16/06G01N33/577G01N33/68
CPCC07K14/5425C12N15/70C12N15/85A61K38/206A61K39/39A61P37/04C07K16/244C07K16/06G01N33/577G01N33/6869C12N2800/106A61K2039/55527A61K2039/552G01N2333/5425
Inventor商绍彬贺双江郝小利杨奕
OwnerYANGZHOU UNIV