Biomineralization nano material for treating Duchenne muscular dystrophy and gene editing system
A Duchenne muscle nutrition and gene editing technology, which is applied in the fields of biomineralized nanomaterials and gene editing systems to achieve the effects of high activity, fast and simple preparation method and low preparation cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] This example is to prepare a biomineralized nanomaterial, which includes 1 part by volume of carbonate, 2 to 5 parts of soluble calcium salt, 0.5 part of polymer coating material, and 18 parts of buffer solution. ~20 parts; wherein, the soluble phosphate includes but not limited to Na 2 CO 3 and K 2 CO 3 , its concentration is 40~200mM; The soluble calcium salt includes but not limited to CaCl 2 , its concentration is 180~460mM; The polymer coating material includes but not limited to PVP or PAA, its concentration is 1M; The buffer solution is selected to contain 50mM Tris-HCl, 300mM NaCl and 20% glycerol compound buffer , and its pH is controlled at 8.0, without carbonate, to ensure the control of the particle size of the nanoparticles coated with polymer materials, and to ensure the effect of endocytosis by cells. The preparation method of the biomineralization nano-material described in this embodiment is: firstly mix the carbonate with 0.1-10 μg of the loaded su...
Embodiment 2
[0063] This example is based on the mineralization method of biomineralized nanomaterials in Example 1, carrying the constructed CRISPR / Cas9 plasmid to form a nano-gene editing system. The structure of the gene editing system is as followsfigure 1 shown. The specific process of loading and biomineralization of the target plasmid is as follows:
[0064] In this example, the constructed CRISPR / Cas9 plasmid is a variant of CRISPR gene editing system without PAM restriction, and its target sequence is designed as any one of SEQ51-1~SEQ51-4:
[0065] SEQ51-1: CACCAGAGCTAACACTCTGAGTAG,
[0066] SEQ51-2: TCACCAGAGCTAACACTCTGAGTA,
[0067] SEQ51-3: GTGGTCTCATTGTCAGACTCATC,
[0068] SEQ 51-4: AGTGGTCTCATTGTCAGACTCAT.
[0069] The specific loading and biomineralization process is as follows:
[0070] 1) Plasmid preparation: Co-incubate the designed CRISPR / Cas9 plasmid system with protamine to form the target plasmid to be carried; the nuclear localization sequence on protamine can h...
Embodiment 3
[0078] This example is to measure the biological toxicity of the gene editing system constructed in Example 2. details as follows:
[0079] 1) Cell co-incubation toxicity test. First, resuspend the prepared biomineralized nanoparticles carrying the target plasmid in DMEM to obtain biomineralized nanoparticle resuspensions with concentrations of 2 mg / mL, 4 mg / mL, 6 mg / mL, 8 mg / mL and 10 mg / mL For biological toxicity test, while using PBS as a control. Inoculate MCF-7 cells in a 96-well plate (5×103 cells per well), and add the biomineralized nanoparticle suspension and PBS prepared above at different concentrations after 24 hours. The amount added is based on the volume of the cell culture medium Add in a ratio of 1:10, put it in the cell culture incubator for 48 hours, then add MTT reagent to each well, and incubate in the CO2 incubator for 4 hours, blue-purple crystals are precipitated in each well, that is, MTT is absorbed by mitochondria. Succinate dehydrogenase was redu...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



