Biomineralization nano material for treating Duchenne muscular dystrophy and gene editing system

A Duchenne muscle nutrition and gene editing technology, which is applied in the fields of biomineralized nanomaterials and gene editing systems to achieve the effects of high activity, fast and simple preparation method and low preparation cost

Pending Publication Date: 2022-05-17
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, how to use nanomaterials to deliver CRISPR to treat DMD is still rarely reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biomineralization nano material for treating Duchenne muscular dystrophy and gene editing system
  • Biomineralization nano material for treating Duchenne muscular dystrophy and gene editing system
  • Biomineralization nano material for treating Duchenne muscular dystrophy and gene editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] This example is to prepare a biomineralized nanomaterial, which includes 1 part by volume of carbonate, 2 to 5 parts of soluble calcium salt, 0.5 part of polymer coating material, and 18 parts of buffer solution. ~20 parts; wherein, the soluble phosphate includes but not limited to Na 2 CO 3 and K 2 CO 3 , its concentration is 40~200mM; The soluble calcium salt includes but not limited to CaCl 2 , its concentration is 180~460mM; The polymer coating material includes but not limited to PVP or PAA, its concentration is 1M; The buffer solution is selected to contain 50mM Tris-HCl, 300mM NaCl and 20% glycerol compound buffer , and its pH is controlled at 8.0, without carbonate, to ensure the control of the particle size of the nanoparticles coated with polymer materials, and to ensure the effect of endocytosis by cells. The preparation method of the biomineralization nano-material described in this embodiment is: firstly mix the carbonate with 0.1-10 μg of the loaded su...

Embodiment 2

[0063] This example is based on the mineralization method of biomineralized nanomaterials in Example 1, carrying the constructed CRISPR / Cas9 plasmid to form a nano-gene editing system. The structure of the gene editing system is as followsfigure 1 shown. The specific process of loading and biomineralization of the target plasmid is as follows:

[0064] In this example, the constructed CRISPR / Cas9 plasmid is a variant of CRISPR gene editing system without PAM restriction, and its target sequence is designed as any one of SEQ51-1~SEQ51-4:

[0065] SEQ51-1: CACCAGAGCTAACACTCTGAGTAG,

[0066] SEQ51-2: TCACCAGAGCTAACACTCTGAGTA,

[0067] SEQ51-3: GTGGTCTCATTGTCAGACTCATC,

[0068] SEQ 51-4: AGTGGTCTCATTGTCAGACTCAT.

[0069] The specific loading and biomineralization process is as follows:

[0070] 1) Plasmid preparation: Co-incubate the designed CRISPR / Cas9 plasmid system with protamine to form the target plasmid to be carried; the nuclear localization sequence on protamine can h...

Embodiment 3

[0078] This example is to measure the biological toxicity of the gene editing system constructed in Example 2. details as follows:

[0079] 1) Cell co-incubation toxicity test. First, resuspend the prepared biomineralized nanoparticles carrying the target plasmid in DMEM to obtain biomineralized nanoparticle resuspensions with concentrations of 2 mg / mL, 4 mg / mL, 6 mg / mL, 8 mg / mL and 10 mg / mL For biological toxicity test, while using PBS as a control. Inoculate MCF-7 cells in a 96-well plate (5×103 cells per well), and add the biomineralized nanoparticle suspension and PBS prepared above at different concentrations after 24 hours. The amount added is based on the volume of the cell culture medium Add in a ratio of 1:10, put it in the cell culture incubator for 48 hours, then add MTT reagent to each well, and incubate in the CO2 incubator for 4 hours, blue-purple crystals are precipitated in each well, that is, MTT is absorbed by mitochondria. Succinate dehydrogenase was redu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a biomineralization nanometer material for treating Duchenne muscular dystrophy and a gene editing system, the biomineralization nanometer material comprises the following components by volume: 1 part of carbonate, 2-5 parts of soluble calcium salt, 0.5 part of a polymer coating material, and 18-20 parts of a buffer solution; wherein the carbonate comprises, but is not limited to, Na2CO3 and K2CO3; the soluble calcium salt comprises but is not limited to CaCl2; the polymer coating material comprises but is not limited to PVP (Polyvinyl Pyrrolidone) and PAA (Polyacrylamide); the pH value of the buffer solution is 7-8, and the buffer solution does not contain carbonate; the biomineralized nano material can efficiently carry CRISPR / Cas9 plasmids, can protect the plasmids from being degraded in serum, and realizes gene editing in cells and organisms. The gene editing system provided by the invention adopts the biomineralized nano material as a basic carrier to carry a CRISPR / Cas9 plasmid system for treating Duchenne muscular dystrophy, and has wide application prospects and medical values.

Description

technical field [0001] The invention relates to a biomineralized nanomaterial and a gene editing system for treating Duchenne muscular dystrophy. Background technique [0002] Duchenne muscular dystrophy, also known as pseudohypertrophic muscular dystrophy (DMD), is caused by mutations in the dystrophin gene (Dystrophin, Dys). DMD is a recessive genetic disease and the most common inherited muscle disorder in early childhood, with a prevalence of 1 / 5000 in males. The DMD gene encodes dystrophin, which is associated with the sarcolemma of cardiac and skeletal muscles and is critical for maintaining and supporting the structure and function of muscle tissue. Mutations in the DMD gene lead to loss of dystrophin expression, leading to severe muscle atrophy, myocardial failure, and respiratory failure in DMD patients, and most patients die before the age of 30. [0003] Mutations in the DMD gene are primarily caused by exon deletions that lead to mutations in stop codons that d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61P21/00B82Y5/00B82Y40/00
CPCA61K48/005A61K48/0041A61K48/0033A61P21/00B82Y5/00B82Y40/00
Inventor韩鹤友杜墨青李烁钧
OwnerHUAZHONG AGRI UNIV