Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant saccharomyces cerevisiae for producing alpha-cubene and application thereof

A strain of Saccharomyces cerevisiae and the technology of cubene, applied in the field of metabolic engineering and bioengineering, can solve problems such as high cost, consumption of petroleum resources, environmental pollution, etc., and achieve the effects of easy transformation, fast metabolism and reduced consumption

Pending Publication Date: 2022-06-28
HUBEI UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, α-Cubacene is mainly synthesized by chemical method, but the current chemical synthesis method is not only costly, but also causes environmental pollution and consumes precious petroleum resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant saccharomyces cerevisiae for producing alpha-cubene and application thereof
  • Recombinant saccharomyces cerevisiae for producing alpha-cubene and application thereof
  • Recombinant saccharomyces cerevisiae for producing alpha-cubene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Synthesize the gene PnTPS3 (nucleotide sequence shown in SEQ ID No. 4) encoding α-cubane synthase, using the PnTPS3 gene as a template, by using the following primers to PCR amplify the PnTPS3 gene fragment:

[0029] PnTPS3 upstream primer: AACTCCGGACCGCGGAGATCTATGGGCTTTTCTTTTGTAAC,

[0030] PnTPS3 downstream primer: AGAATTGTTAATTAAAGATCTTTAGAGGGGGATAGGTTGGA.

[0031] The pY26TEF-GPD was digested with BglII enzyme to obtain the linearized pY26TEF-GPD plasmid, and then the amplified PnTPS3 gene fragment and the linearized pY26TEF-GPD plasmid were connected by homologous recombination (recombinase was purchased from Nanjing Nuowei) Zan company, product number C115), obtained plasmid pY26TEF-GPD-PnTPS3, its schematic diagram is shown in figure 1 .

[0032] The plasmid pY26TEF-GPD-PnTPS3 was transformed into Saccharomyces cerevisiae BY4741, and the successful transformants were screened by uracil auxotrophy to obtain the strain BY4741 / pY26TEF-GPD-PnTPS3, and the successfu...

Embodiment 2

[0040] The same as Example 1, the difference is that the farnesyl pyrophosphate synthase gene (nucleotide sequence shown in SEQ ID No. 5) is further overexpressed to increase the amount of farnesyl pyrophosphate in Saccharomyces cerevisiae.

[0041] The plasmid pY26TEF-GPD-PnTPS3 constructed in Example 1 was selected. The gene encoding farnesyl pyrophosphate synthase ERG20 was constructed into plasmid pY26TEF-GPD-PnTPS3 to obtain plasmid pY26TEF-GPD-PnTPS3-ERG20.

[0042] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the ERG20 gene fragment was amplified by PCR using the following primers:

[0043] ERG20 upstream primer: GATTCTAGAACTAGTGGATCCATGGCTTCAGAAAAAAGAAAT,

[0044] ERG20 downstream primer: TTCCTGCAGCCCGGGGGATCCTTATTTGCTTCTCTTGTAAA.

[0045] The pY26TEF-GPD-PnTPS3 was digested with BamHI enzyme to obtain the linearized pY26TEF-GPD-PnTPS3 plasmid, and then the amplified ERG20 gene fragment and the linearized pY26TEF-GPD-PnTPS3 plasmid were connecte...

Embodiment 3

[0050] Same as Example 2, the difference is that α-cubane synthase and farnesyl pyrophosphate synthase are fused and expressed.

[0051] The plasmid pY26TEF-GPD was selected. The gene ERG20 encoding farnesyl pyrophosphate synthase and the gene PnTPS3 encoding α-cubane synthase were constructed on plasmid pY26TEF-GPD to obtain plasmid pY26TEF-GPD-PnTPS3-L-ERG20.

[0052] Using the PnTPS3 gene as a template, the PnTPS3 gene fragment was amplified by PCR using the following primers:

[0053] PnTPS3 upstream primer: AACTCCGGACCGCGGAGATCTATGGGCTTTTCTTTTGTAAC,

[0054] PnTPS3 downstream primer: GAGGGGGATAGGTTGGACAA.

[0055] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the ERG20 gene fragment was amplified by PCR using the following primers:

[0056] ERG20 upstream primer: TCCAACCTATCCCCCTCGGTTCTGGTATGGCTTCAGAAAAAGAAAT,

[0057] ERG20 downstream primer: AGAATTGTTAATTAAAGATCTTTATTTGCTTCTCTTGTAAA.

[0058] The pY26TEF-GPD was digested with BglII enzyme to ob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant saccharomyces cerevisiae for producing alpha-cubene and application of the recombinant saccharomyces cerevisiae, and belongs to the field of metabolic engineering and bioengineering. According to the recombinant saccharomyces cerevisiae strain for producing alpha-cubene, saccharomyces cerevisiae is taken as a host, alpha-cubene synthase is subjected to heterologous expression, and farnesyl pyrophosphate synthase and isopentenyl pyrophosphate isomerase are subjected to overexpression. The recombinant saccharomyces cerevisiae strain for producing the alpha-cubene is obtained by transferring recombinant plasmids capable of expressing an alpha-cubene synthase gene, a farnesyl pyrophosphate synthase gene and an isopentenyl pyrophosphate isomerase gene into saccharomyces cerevisiae. According to the invention, the exogenous gene is introduced into the saccharomyces cerevisiae to produce the alpha-cubene, and petroleum resources are not required to be used for chemical synthesis, so that the consumption of the petroleum resources and the pollution to the environment are reduced, and the sustainable development is realized. The alpha-cubene can be efficiently produced, and the application of the alpha-cubene in the fields of food, medicine, agriculture, tobacco and the like is promoted.

Description

technical field [0001] The invention belongs to the fields of metabolic engineering and bioengineering, in particular to a recombinant saccharomyces cerevisiae producing α-cubane and its application. Background technique [0002] Alpha-Cubaene, Molecular Formula C 15 H 24 , molecular weight 204.35, a tricyclic sesquiterpene, is an important biologically active substance that naturally exists in many medicinal and aromatic plants. As an important plant active ingredient, α-Cubaene is widely used in food, medicine, agriculture and other fields, and has various functional properties. Some studies have shown that essential oils rich in alpha-cubane have antioxidant, anti-mutagenic, analgesic, anti-inflammatory, hepatoprotective, anti-plasma parasite and inhibitory effects on Staphylococcus aureus, Candida albicans, Bacillus subtilis, etc. In addition, α-cubane has antitumor activity and has the potential to be an effective anticancer drug. In the agricultural field, α-Cubaen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/54C12N15/60C12N15/61C12N15/81C12P5/00C12R1/865
CPCC12N9/1085C12N9/88C12N9/90C12N15/52C12N15/81C12P5/007C12Y402/03133C12Y205/0101C12Y503/03002Y02E50/10
Inventor 柳志杰汪超徐宁胡勇祁勇刚李玮周梦舟吴茜
Owner HUBEI UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com