MeHsf23 gene for improving disease resistance of cassava and application of MeHsf23 gene
A disease resistance, cassava technology, applied in the field of molecular biology, can solve the problems of lack of cassava bacterial wilt, cassava production impact, non-resistance to bacterial wilt, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Cloning and bioinformatics analysis of MeHsf23 gene
[0042] 1.1 Cloning of MeHsf23 gene
[0043] The total RNA of cassava SC8 leaves was extracted by TRIzol method. The concentration and purity of the extracted total RNA were detected by microspectrophotometer. The quality of the extracted total RNA was detected by 1% agarose gel electrophoresis. RevertAidTM First StrandcDNA Synthesis Kit was used for reverse transcription. As cDNA, according to the sequence information of the cassava MeHsf23 gene, the amplification primers MeHsf23-F: GTCGAATTCCCCTCCCCCTTAATTTAATT, MeHsf23-R: CATGGATCGAGAAAAGTGTCGAACCATT were designed using Premier 5.0 software. Take the cDNA obtained by total RNA reverse transcription as a template to carry out PCR amplification, clone the cassava MeHsf23 gene coding region sequence, and obtain a target fragment with a size of about 750bp after the amplification ( figure 1 ). The reaction system is: TaKaRa LA Taq 0.2 μL, 10xLA PCR Buffer 2 μ...
Embodiment 2
[0054] Example 2 Expression pattern analysis of MeHsf23 gene after XamHN11 treatment
[0055] The cassava inoculated with bacterial wilt of cassava XamHN11 was taken, and the total RNA of cassava was extracted at 3h, 6h, 1d, 3d and 6d after inoculation, and reverse transcribed into cDNA. qRT-MeHsf23-F: GACATGTTTCGAAAGGGTGAAA; qRT-MeHsf23-R: TAGTGAGCTCCGAACTCAATAC was designed with Premier 5.0 software, and the real-time PCR reaction system was: TB Green Premix Ex TaqⅡ(2x) 10 μL, upstream and downstream primers were 1 μL each, and cDNA was 2 μL , plus ddH 2 O supplemented to 20 μL. The reaction program was: pre-denaturation at 95 °C for 30 s; 40 cycles included denaturation at 95 °C for 5 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 5 min. Three replicates were set for each sample, with EF1α as the reference gene. Gene expression values were calculated using the 2-ΔΔCt method.
[0056] The result is as Figure 7 The result...
Embodiment 3
[0057] Example 3 pCsCMV-mediated gene silencing of MeHsf23
[0058] 3.1 Infection of cassava with VIGS vector pCsCMV-NC
[0059] The VIGS recombinant vector pCsCMV-MeHsf23, positive control pCsCMV-B and negative control pCsCMV-A were transformed into Agrobacterium GV3101 (pSoup-p19) competent cells, wherein the positive control was a recombinant plasmid containing viral genes and indicator genes, and the negative control was only Plasmids containing viral genes were picked, and positive clones identified by colony PCR were picked into 5 mL LB (50 μg / mL kanamycin + 25 μg / mL rifampicin) liquid medium, and cultured overnight at 28°C and 220 rpm. Take 500 μL of overnight cultured bacterial solution in 50 mL of LB (50 μg / mL kanamycin + 25 μg / mL rifampicin) liquid medium, 28 ° C, 220 rpm to OD 600 The value is 0.75. The bacterial solution was transferred to a 50 mL centrifuge tube, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. Add an appropriate amount of ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More