Fusion anticaries DNA vaccine and its preparation
A technology of DNA vaccine and DNA sequence, applied in the direction of drug combination, pharmaceutical formula, medical preparations containing active ingredients, etc., can solve the problems of high cost, short duration, difficult preparation and purification of polypeptides, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0045] Below in conjunction with accompanying drawing, the present invention is described in further detail:
[0046] according to Figure 1-6 It can be seen that using professional molecular biology software: DNASIS comprehensive DNA sequence analysis software, Gene Construction kit 2.0 gene simulation cloning software, Omiga comprehensive molecular biology analysis software, BLAST homologous sequence analysis software, Oligo primer design analysis software and other software to analyze and design GTF -PAc is fused with an anti-caries DNA vaccine and simulates the whole process of cloning. The primers in the GLU region were designed as follows: positive-strand primer: 5'TCACTCGAGGTACCGGAGAAATGGGCTATCAA3'; negative-strand primer: 5'CCCGGGTTAGTCGACAATCCGAACTCGTTC3', KpnI and SalI restriction sites were introduced at the 5' ends of the positive-strand and negative-strand primers, respectively. Using the polymerase chain reaction (PCR) method, the plasmid pYNB13 carrying the gen...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap