Chlamys Farreri H2A gene clone and N terminal expression technology

A scallop and gene technology, which is applied in the production of medicines, feed additives, and the production of preservatives and preservatives, clones the complete DNA sequence and amino acid sequence of the histone gene H2A of scallop, and can solve the problem of farming scallops. Mass deaths, heavy economic losses, etc.

Inactive Publication Date: 2006-07-12
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since 1994, farmed shellfish began to die on a large scale, and the economic loss was very heavy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlamys Farreri H2A gene clone and N terminal expression technology
  • Chlamys Farreri H2A gene clone and N terminal expression technology
  • Chlamys Farreri H2A gene clone and N terminal expression technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Implementation example 1. A cloned Chlamys farreri H2A gene has the following sequence:

[0069] sequence listing

[0070] (1) Information on SEQ ID NO 1

[0071] sequence feature

[0072] Length: 606 base pairs

[0073] Type: nucleic acid

[0074] Chain type: double chain

[0075] Topology: Linear

[0076] Source: Chlamys farreri

[0077] Sequence description:

[0078] ATGTCTGGACGAGGAAAGGGAGGAAAAGTTAAGGGAAAGGCAAAGAGCCGATCATCCCGTGCC

[0079] GGGCTTCAGTTTCCAGTCGGACGTATCCATCGTCTGCTCCGTAAGGGAAACTATGCCGAGAGA

[0080] GTTGGAGCCGGTGCCCCAGTCTACTTGGCTGCTGTCCTCGAGTACTTAGCTGCTGAGGTTTTG

[0081] GAATTGGCAGGAAACGCCGCTAGAGATAACAAGAAGACCAGGATCATCCCCCGTCATCTCCAG

[0082] TTGGCTATCAGGAACGACGAGGAGTTGAACAAACTGCTGTCCGGTGTCACCATTGCCCAGGGT

[0083] GGTGTTCTGCCAAACATCCAGGCTGTCCTTCTCCCCCAAGAAGACCCAGAAACCTGCCAAGTAA

[0084] ACAGTTCCGGCGTCATTTGGCTCCACACAAAACGGCCCTTTTCAGGGCCACCCACATTACTCA

[0085] AAAAGTATCCTTATGAACTACCTCGAAATTATACGCAAAAAAAAAACAACAACAAGAACAAAC

[0086] AAACACAGGTCC...

Embodiment 2

[0111] Implementation example 2. Cloning and expression method of the gene of Chlamys farreri H2A

[0112] 1. Extraction and purification of Chlamys scallop genomic DNA: The total DNA was extracted from Chlamys scallop muscle column using the DNA extraction and purification Kit of Beijing Saibaisheng Technology Co., Ltd., and the quality of the extracted DNA was determined by Bechman730 spectrophotometer (Li Taiwu, Li Chenghua et al. 2003).

[0113] 2 Construction of the genomic library of Chlamys farreri: it is characterized in that, the construction of the genomic library utilizes the Universal GenomeWalker of Clontech Company TM Kit to build.

[0114] 3. Cloning of the full-length sequence of gene cluster DNA containing H2A in Chlamys farreri: According to the obtained amino acid sequence of H2A, use multiple sequence alignment software to find out its conserved amino acid positions, and design corresponding merger primers GSPF: 5 '-AAYGAYGARGARYTRAAYAA-3' and specific l...

Embodiment 3

[0128] Example 3: Inhibitory activity of recombinant H2A N-terminal products on bacteria in vitro

[0129] Antimicrobial peptides have antibacterial activity in vitro, so we studied the inhibitory activity of the recombinant H2A N-terminus in Examples 4-5 on Gram-positive and Gram-negative bacteria in vitro. Using the agar well diffusion method, Micrococcus luteus and Vibrio luteus were used as test strains to test the activity of the expression product, and cultured in SOB liquid medium until O.D. 600 0.6, take 400μl of bacterial suspension and mix with 100mL of solid medium, and spread it in a sterile petri dish. After solidification, make a small hole with a diameter of 2mm in the petri dish, and drop 10μl and 20μl into the hole respectively, 50 μl of the supernatant of the blank control group and the supernatant of the test group were cultured overnight at 37°C to observe the antibacterial effect. The results showed that the recombinant H2A N-terminal product showed obvio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a scallop protein H2A gene clone and the monoclonal expression technique of N end antibiotic polypeptide in the field of molecular biology technique. It uses isogenesis clone technique to obtain the scallop group protein H2A gene group total length; the gene DNA has a 375bp open reading frame with the coding 125 amino acids, 3' non-coding area comprises two ending signals which are stem ring structure and polyadenylic acid rear signal. It uses pPIC9K expressing carrier to express the protein N end 30aa in Pichia pastoris, the expressing product has bacterial inhibition to the Micrococcus luteus and the Vibrio splendidus.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to the cloning and N-terminal expression technology of Chlamys farreri H2A gene, specifically clones the full DNA sequence and amino acid sequence of Chlamys farreri histone gene H2A from Chlamys farreri genome, and also The invention relates to the application of the gene and its N terminal in the production of medicine, feed additive, antiseptic and fresh-keeping agent. Background technique [0002] Antimicrobial peptides are a class of amphipathic small molecule basic polypeptides that widely exist in the entire biological world, and are key factors in the body's innate immunity. After Steiner first discovered in celestial silkworm, so far, more than 800 kinds of antimicrobial peptides have been found in various organisms. According to the sequence, secondary structure and antibacterial properties of antimicrobial peptides, the discovered antimicrobial peptides are divid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/81C12N15/10A61K38/16A23K1/16A23L3/34A23K20/142A23K20/153
Inventor 宋林生李成华赵建民相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap