Conjugated protein Tau of microtubule of earthworm, its coding gene, and application
A protein and amino acid technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: Preparation of earthworm total RNA
[0034] Step 1: Handling and preparation of laboratory equipment
[0035] 1) Plastic products: (including pipette tips, EP tubes, homogenate tubes, etc.)
[0036] First pour DEPC (diethyl pyrocarbonate) water from the volumetric flask into the ceramic jar, and soak the plastic products in it one by one. The small gun tip needs to be injected with DEPC water through a straw, overnight, then high pressure, and then dried for later use. Put the tip of the gun into the tip table before putting it into the tip table, and then press it again (EP tube);
[0037] 2) Glass products: Soak in acid overnight, rinse well, and dry with tin foil for later use (DEPC blisters) (after washing, soak in 1‰ DEPC overnight, then dry);
[0038] 3) Homogenizer: (including scissors, tweezers) wash first, then high pressure (no need to soak DEPC);
[0039] 4) Roast the scissors used for tissue removal on the fire.
[0040] S...
Embodiment 2
[0068] Embodiment 2 obtains Etau by RT-PCR
[0069] The following oligonucleotide sequences were chemically synthesized (Shanghai Sangong):
[0070]Primer 1: 5'ATGGAGCCCCGCCAGGAGTTCGAA 3'
[0071] Primer 2: 5'CAAACCCTGCTTGGCCAGGGAGGC 3'
[0072] The earthworm total RNA in Example 1 was taken, and RT-PCR one step kit (Qiagen Inc.) was used to operate according to the method described in the manual. Using primer 1 and primer 2, use Taq DNA polymerase to carry out PCR reaction, incubate at 95°C for 5 minutes, after incubating at 50°C for 30 minutes, enter the following cycle: denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute , cycled 35 times, extended at 72°C for 10 minutes, and cooled to 4°C to obtain the nucleotide sequence of Etau. The obtained DNA was cloned into the EcoR I site of the cloning vector pBluescript II KS-plasmid (NOVAGEN), and its sequence is shown in SEQ ID NO.1.
[0073] According to the ...
Embodiment 3
[0074] Example 3: Determination of the restriction enzyme map of Etau and construction of various subclones
[0075] Step 1: Carry out single-digestion, double-digestion and multiple-digestion on the Etau clone of the present invention, and calculate the size of each fragment by agarose gel electrophoresis, analyze its multiple cloning site, and draw a restriction enzyme map ,See image 3 .
[0076] Step 2: Digest Etau with Pst I, and recover the digested fragment by agarose gel electrophoresis, then use the pET28a vector to digest it with the same enzyme (Pst I), and finally construct the sub Clones A and B; Etau was double digested with Pfu I / Ace II to construct subclone C; in addition, BlpI / Pfu I, Pfu I / Pst I, Pst I / Hind III, Pfu I / BsrFI, BsrF were respectively used I / Xho I and Ace II / Xho I double digested Etau to construct subclones D, E, F, G, H and I; a total of 9 subclones with different fragment sizes of Etau were obtained, but not limited to this, See Figure 9 . ...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com