Supercharge Your Innovation With Domain-Expert AI Agents!

Conjugated protein Tau of microtubule of earthworm, its coding gene, and application

A protein and amino acid technology, applied in the field of genetic engineering

Inactive Publication Date: 2006-12-06
INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] So far, although Tau protein has been found in many animal species and a lot of research has been done on its function, there has never been a report of Tau protein found in earthworms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Conjugated protein Tau of microtubule of earthworm, its coding gene, and application
  • Conjugated protein Tau of microtubule of earthworm, its coding gene, and application
  • Conjugated protein Tau of microtubule of earthworm, its coding gene, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Preparation of earthworm total RNA

[0034] Step 1: Handling and preparation of laboratory equipment

[0035] 1) Plastic products: (including pipette tips, EP tubes, homogenate tubes, etc.)

[0036] First pour DEPC (diethyl pyrocarbonate) water from the volumetric flask into the ceramic jar, and soak the plastic products in it one by one. The small gun tip needs to be injected with DEPC water through a straw, overnight, then high pressure, and then dried for later use. Put the tip of the gun into the tip table before putting it into the tip table, and then press it again (EP tube);

[0037] 2) Glass products: Soak in acid overnight, rinse well, and dry with tin foil for later use (DEPC blisters) (after washing, soak in 1‰ DEPC overnight, then dry);

[0038] 3) Homogenizer: (including scissors, tweezers) wash first, then high pressure (no need to soak DEPC);

[0039] 4) Roast the scissors used for tissue removal on the fire.

[0040] S...

Embodiment 2

[0068] Embodiment 2 obtains Etau by RT-PCR

[0069] The following oligonucleotide sequences were chemically synthesized (Shanghai Sangong):

[0070]Primer 1: 5'ATGGAGCCCCGCCAGGAGTTCGAA 3'

[0071] Primer 2: 5'CAAACCCTGCTTGGCCAGGGAGGC 3'

[0072] The earthworm total RNA in Example 1 was taken, and RT-PCR one step kit (Qiagen Inc.) was used to operate according to the method described in the manual. Using primer 1 and primer 2, use Taq DNA polymerase to carry out PCR reaction, incubate at 95°C for 5 minutes, after incubating at 50°C for 30 minutes, enter the following cycle: denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute , cycled 35 times, extended at 72°C for 10 minutes, and cooled to 4°C to obtain the nucleotide sequence of Etau. The obtained DNA was cloned into the EcoR I site of the cloning vector pBluescript II KS-plasmid (NOVAGEN), and its sequence is shown in SEQ ID NO.1.

[0073] According to the ...

Embodiment 3

[0074] Example 3: Determination of the restriction enzyme map of Etau and construction of various subclones

[0075] Step 1: Carry out single-digestion, double-digestion and multiple-digestion on the Etau clone of the present invention, and calculate the size of each fragment by agarose gel electrophoresis, analyze its multiple cloning site, and draw a restriction enzyme map ,See image 3 .

[0076] Step 2: Digest Etau with Pst I, and recover the digested fragment by agarose gel electrophoresis, then use the pET28a vector to digest it with the same enzyme (Pst I), and finally construct the sub Clones A and B; Etau was double digested with Pfu I / Ace II to construct subclone C; in addition, BlpI / Pfu I, Pfu I / Pst I, Pst I / Hind III, Pfu I / BsrFI, BsrF were respectively used I / Xho I and Ace II / Xho I double digested Etau to construct subclones D, E, F, G, H and I; a total of 9 subclones with different fragment sizes of Etau were obtained, but not limited to this, See Figure 9 . ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

This invention provides E-Tau protein expressed by E-tau gene produced from Lumbricus terrestris total RNA by RT-PCR, recombinant vector containing E-tau gene and its subclones, recombinant microorganisms, eukaryotic expression vector containing E-tau gene and relevant transfected cell lines. E-tau gene is a new type of microtubule-associated gene, which is closely related to Alzheimer's disease. E-Tau protein can accelerate microtubule assembly and stabilize microtubule net. This invention also relates to the application of E-tau gene in neurodegenerative disease treatment.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular, the invention relates to a gene Etau encoding a microtubule binding protein of earthworms. The present invention also relates to the function of the protein encoded by the gene, the recombinant vector containing the above gene sequence and its subclones and recombinant microorganisms, as well as the eukaryotic expression vectors and transfected cell lines obtained from these subclones. In addition, the present invention also relates to the function of the gene in the assembly of neuron microtubules and its application in the study of neurodegenerative diseases in clinical medicine. Background technique [0002] In 1975, Weingarten et al. discovered a protein with high affinity to microtubule proteins in the process of studying the molecular structure of the neuron microtubule system, and classified it as a microtubule associated protein (MAP), named For neural tau. The protein ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/63C12N15/79C07K19/00A61K38/16A61P25/28
Inventor 赫荣乔赵静王东亮王兴胜赫坚
Owner INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More