Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for enhancing proliferation or differentiation of a cell using OB protein

a technology of ob protein and ob protein, which is applied in the field of wsx receptors, can solve the problems of limiting the lineage of these receptors and affecting the biochemical characterization of these receptors, and achieve the effects of stimulating the mobilization of hematopoietic stem cells and improving the engraftment of bone marrow transplantation

Inactive Publication Date: 2005-12-08
GENENTECH INC
View PDF42 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0027] In another embodiment, an effective amount of the WSX ligand may be used to improve engraftment in bone marrow transplantation or to stimulate mobilization of hematopoietic stem cells in a mammal prior to harvesting hematopoietic progenitors from the peripheral blood thereof.
[0030] Pharmaceutical compositions of the WSX receptor ECD may further include a WSX ligand. Such dual compositions may be beneficial where it is therapeutically useful to prolong the half-life of WSX ligand and / or activate endogenous WSX receptor directly as a heterotrimeric complex.
[0037] For certain applications, it is desirable to have an agonist antibody which can be screened for as described herein. Such agonist antibodies are useful for activating the WSX receptor for in vitro uses whereby enhancement of proliferation and / or differentiation of a cell comprising the receptor is desired. Furthermore, these antibodies may be used to treat conditions in which an effective amount of WSX receptor activation leads to a therapeutic benefit in the mammal treated therewith. For example, the agonist antibody can be used to enhance survival, proliferation and / or differentiation of a cell comprising the WSX receptor. In particular, agonist antibodies and other WSX ligands may be used to stimulate proliferation of stem cells / progenitor cells either in vitro or in vivo. Other potential therapeutic applications include the use of agonist antibodies to treat metabolic disorders (such as obesity and diabetes) and to promote kidney, liver or lung growth and / or repair (e.g., in renal failure).
[0040] In addition to the above, the invention provides isolated nucleic acid molecules, expression vectors and host cells encoding the WSX receptor which can be used in the recombinant production of WSX receptor as described herein. The isolated nucleic acid molecules and vectors are also useful for gene therapy applications to treat patients with WSX receptor defects and / or to increase responsiveness of cells to WSX ligand.

Problems solved by technology

As stem cells progressively lose their ability to self-renew, they become increasingly lineage restricted.
Due to their low abundance and their existence in both high-affinity and low-affinity forms, biochemical characterization of these receptors has been hampered.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enhancing proliferation or differentiation of a cell using OB protein
  • Method for enhancing proliferation or differentiation of a cell using OB protein
  • Method for enhancing proliferation or differentiation of a cell using OB protein

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning of Human WSX Receptor

[0341] An oligonucleotide probe designated WSX.6 #1 was synthesized based upon the T73849 EST sequence. The WSX.6 #1 probe was a 51mer having the following sequence:

5′ GTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTC(SEQ ID NO:45)TATGCTGTTCAGGTGCGC-3′.

[0342] The radiolabeled WSX.6 #1 probe was used to probe 1.2×106 clones from a random and oligo dT primed λgt10 fetal liver library (Clontech, Palo Alto, Calif.). Following hybridization at 42° C. overnight, the filters were washed at 50° C. in 0.5×SSC and 0.1% NaDodSO4 (SDS). From the initial screen, 10 clones were selected and upon subsequent screening 5 individual plaque pure clones were isolated. Of these 5 individual clones, four clones designated 1, 5, 6 and 9 were subcloned into pBSSK− (Stratagene) following EcoRI digestion. Sequence analysis revealed clone 5 and clone 9 contained the putative initiation methionine and signal peptide. Clone 6 (designated 6.4) contained the most 3′ end sequence and subsequently w...

example 2

WSX Receptor Immunoadhesin

[0346] Using polymerase chain amplification, a WSX receptor immunoadhesin was created by engineering an in-frame fusion of the WSX receptor gene extracellular domain (WSX.ECD) with human CH2CH3(Fc)IgG (Bennett et al., J. Biol. Chem. 266(34):23060-23067 (1991)) at the C terminus of the ECD and cloned into pBSSK− (Stratagene). For expression, the WSX-Fc was excised with ClaI and BstEI and ligated into the pRK5.HuIF.grbhlgG Genenase I vector (Beck et al., Molecular Immunology 31(17):1335-1344 (1994)), to create the plasmid pRK5.WSX-IgG Genenase I. This plasmid was transiently transfected into 293 cells using standard calcium phosphate transfection techniques. The transfected cells were cultured at 37° C. in 5% CO2 in DMEM F12 50:50 supplemented with 10% FBS, 100 mM HEPES (pH 7.2) and 1 mM glutamine. The WSX receptor immunoadhesin was purified using a ProSepA™ protein A column.

example 3

Antibody Production

[0347] In order to raise antibodies against the WSX receptor, the WSX receptor immunoadhesin of Example 2 was used to inoculate rabbits to raise polyclonal antibodies and mice to raise monoclonal antibodies using conventional technology.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

Uses for WSX ligands in hematopoiesis are disclosed. In particular, in vitro and in vivo methods for stimulating hematopoiesis (e.g., myelopoiesis, erythropoiesis and especially, lymphopoiesis) using a WSX ligand (e.g., anti-WSX receptor agonist antibodies or OB protein), and optionally another cytokine, are described.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This is a continuation of U.S. patent application Ser. No. 08 / 667,197 filed Jun. 20, 1996, which claims priority to U.S. Provisional Patent Application No. 60 / 064,855, filed Jan. 8, 1996, hereby incorporated by reference in their entireties.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention pertains generally to the WSX receptor. In particular, the invention relates to WSX ligands and uses therefor. [0004] 2. Description of the Related Art [0005] Hematopoiesis [0006] The process of blood cell formation whereby red and white blood cells are replaced through the division of cells located in the bone marrow is called hematopoiesis. For a review of hematopoiesis see Dexter and Spooncer (Ann. Rev. Cell Biol. 3:423-441 (1987)). [0007] There are many different types of blood cells which belong to distinct cell lineages. Along each lineage, there are cells at different stages of maturation. Mature blood ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/22A61K38/17
CPCA61K38/2264
Inventor MATTHEWS, WILLIAM
Owner GENENTECH INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More