Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Production of polyketides and other natural products

a technology of polyketide and natural products, applied in the field of polyketide and other natural products production, can solve the problems of limited utility of the approach, difficult work, and less success of the biological approach to producing novel rapamycin analogues

Inactive Publication Date: 2006-04-13
GREGORY MATTHEW +3
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention provides methods for efficiently transforming strains that contain biosynthetic clusters that encode FKBP-ligands, such as rapamycin, using recombinant DNA techniques. These methods involve constructing a conjugative deletion plasmid in an E. coli strain, growing spores from the strain, and culturing the strain under conditions suitable for polyketide production. The invention also provides recombinant strains containing biosynthetic clusters that encode FKBP-ligands where one or more auxiliary genes have been deleted or inactivated. Additionally, the invention provides methods for expressing combinations of polyketide modification enzymes to produce novel polyketide analogues."

Problems solved by technology

Modification using chemically available positions on the molecule has been addressed, however, this approach has limited utility as the sites available for chemical modification are limited and there is less ability to selectively modify a particular position.
Biological approaches to producing novel rapamycin analogues have been less successful due to the difficulties encountered in working with the organism (Lomovskaya et al., 1997; Kieser et al., 2000) despite the availability of the sequence of the biosynthetic gene cluster of rapamycin from S. hygroscopicus (Schwecke et al., 1995).
However, chemical modification requires significant quantities of rapamycin template and, as a base and acid labile compound, it is difficult to work with.
Where chemical derivatisation can be group selective, it is often difficult to be site selective.
These strains are often low yielding and produce mixtures of rapamycin analogues.
The use of such inhibitors, however, only allows the targeting of a particular enzyme function and is not site selective.
Rational production of a single selected analogue is not possible via this method.
The resulting production of mixtures of rapamycin analogues rather than a single desired product also impacts yield.
These novel rapamycin analogues were produced in competition with the natural starter, 4,5-dihydroxycyclohex-1-enecarboxylic acid, resulting in reduced yields and mixed products.
Furthermore, the site-specific functionality of rapM and rapQ remains unclear, therefore, rational design of rapamycin analogues requiring methylation at C16-OH or C27-OH has not been enabled.
It offers a difficult and protracted process of obtaining engineered strains and has a reduced versatility in comparison to the methodology disclosed within this current patent.
However, the isolation of novel rapamycin analogues using such biological methods has been limited due to the difficulties in transforming the rapamycin-producing organism S. hygroscopicus.
It has been reported that the commonly used methods of transformation with plasmid DNA or conjugal transfer were unsuccessful with the rapamycin producing strain (Lomovskya et al., 1997, Schweke et al., 1995, Kieser et al., 2000).
(1997), a work intensive phage based method that is severely limited by the size of the cloned DNA fragments transferred into S. hygroscopicus (Kieser et al., 2000).
This technology is limited to the transfer of a maximum of 6.4 kb of cloned DNA.
Thus, when complementing a deletion mutant using this technology the artisan is limited to the inclusion of ˜2 functional genes in addition to desired promoter, regions of homology and resistance marker.
The genetic information for the rapamycin biosynthetic gene cluster has been available since 1995 (Schwecke et al., 1995), however, limited progress in this area has been made (Khaw et al., 1998; Chung et al., 2001; WO01 / 34816).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of polyketides and other natural products
  • Production of polyketides and other natural products
  • Production of polyketides and other natural products

Examples

Experimental program
Comparison scheme
Effect test

example 1

Conjugation of S. hygroscopicus

[0367] The plasmid to be conjugated into S. hygroscopicus was transformed by electroporation into the dam− dcm− ET12567 E. coli strain containing either pUB307 as described in MacNeil et al. (1992) or pUZ8002 as described in Paget et al. (1999). A preculture was used (over night culture, 30° C.) to inoculate fresh 2×TY (with 50 μg / ml apramycin and 25 μg / ml kanamycin) at a dilution of 1 / 25 and grown with shaking at 37° C. to an optical density at 595 nm of 0.25-0.6. The cells from this broth were washed twice with 2×TY, then resuspended with 0.5 ml of 2×TY per 25 ml original culture. The quality of the spore stock used is critical for the success of this method. In this context the age of the spores when harvested and the use of medium 1 are crucial for the isolation of high-quality spore suspension. To isolate high-quality spore suspensions of S. hygroscopicus, pre-dried plates of medium 1 agar (see Materials and Methods section) were spread with S. h...

example 2

Isolation of the S. hygroscopicus Mutant MG2-10 Carrying the Chromosomal Deletion of rapQONMLKJI (FIG. 4)

[0369] An S. hygroscopicus mutant (MG2-10) in which the rapamycin modifying genes rapQ, rapO / N, rapM, rapL, rapK, rapJ and rapI were deleted was constructed as described below.

Isolation of the Streptomycin Resistant Mutant MG1C:

[0370]S. hygroscopicus NRRL5491 mycelia were spread onto plates of medium 1 containing 50 mg / ml streptomycin. Three colonies were isolated and labelled MG1A, MG1B and MG1C. These were conjugated as in example 1 with the plasmid pMG49, a derivative of pSET152 containing the rpsL gene from S. lividans TK24. Exconjugants from each of these conjugations were patched onto a plate if medium 1 containing 50 mg / ml apramycin and 50 mg / ml nalidixic acid, to confirm the presence of the plasmid pMG49. They were then streaked, along with the original strains MG1A, MG1B and MG1C, onto a both a plate of medium 1 containing no antibiotic and a plate of medium 1 contai...

example 3

Expression of rapK in the S. hygroscopicus Mutant MG2-10 Carrying the Chromosomal Deletion of rapQONMLKJI (FIG. 4)

Construction of Expression Vector pSGset1

[0374] The pSET152 (Bierman et al., 1992a) derived vector pCJR336 (kindly provided by Christine Martin and Corinne Squire) was created by cloning the primer dimer of CR347 5′-TAAACTAGTCCATCTGAGAGTTTCATATGGCCCTATTCTGCCCAGCCGCTCTAG AAAT-3′ (SEQ ID NO: 35) and CR348 5′-ATTTCTAGAGCGGCTGGGCAGAATAGGGCCATATGAAACTCTCAGATGGACTAG TTTA-3′ (SEQ ID NO: 36) into PvuII digested pSET152 using standard molecular biological techniques, thus introducing sites for the restriction enzymes SpeI, NdeI, and XbaI into pSET152. The orientation of the insert was confirmed by sequencing. Plasmid pCJR336 was digested using the restriction enzymes NdeI / SpeI and vector pSG142 (Gaisser et al., 2000) was digested identically. The resulting DNA bands of about 5.4 kb for pCJR336 and 1.2 kb for pSG142 were isolated followed by a ligation which was used to transfo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
humidityaaaaaaaaaa
humidityaaaaaaaaaa
humidityaaaaaaaaaa
Login to View More

Abstract

The present invention relates to production of polyketides and other natural products and to libraries of compounds and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes for their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).

Description

FIELD OF THE INVENTION [0001] The present invention relates to production of polyketides and other natural products and to libraries of compounds and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes for their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains). BACKGROUND OF THE INVENTION [0002] Rapamycin (sirolimus) (FIG. 1) is a lipophilic macrolide produced by Streptomyces hygroscopicus NRRL 5491 (Sehgal et al., 1975; Vézina et al., 1975; U.S. Pat. No. 3,929,992; U.S. Pat. No. 3,993,749) with a 1,2,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N1/21C12N15/74C12N15/09A61K31/407A61K31/436A61K31/706A61P31/10A61P35/00A61P37/04C07D493/18C07D498/18C07H15/04C07K14/36C12N15/10C12N15/52C12N15/70C12N15/76C12P17/18C12P19/62C12R1/55
CPCC07D471/18C07D487/18C07D493/18C12P17/188C12N15/52C12N15/70C12N15/76C07K14/36C07D405/12C07D498/18A61P29/00A61P31/00A61P31/10A61P35/00A61P37/00A61P37/04A61P37/06A61P43/00
Inventor GREGORY, MATTHEWGAISSER, SABINEPETKOVIC, HRVOJEMOSS, STEVEN
Owner GREGORY MATTHEW
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products