Lrp4/corin dopamine-producing neuron proliferation precursor cell marker

a precursor cell and corin dopamine technology, applied in the direction of artificial cell constructs, immunoglobulins against animals/humans, drug compositions, etc., can solve the problems of unsatisfactory effect, risk of infection and contamination, method is currently being criticized, etc., to improve the efficiency of gene expression screening, high sensitivity, and speed

Inactive Publication Date: 2006-10-26
EISIA R&D MANAGEMENT CO LTD
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0076] When using reverse transcription PCR for gene expression analysis, the expression of a specific gene can be roughly quantified. Various isoforms of a single RNA transcription product can also be detected and analyzed using the present method. For reverse transcription PCR, when the reaction is carried out using exon-specific primers, and amplification products other than the predicted product are detected, mRNA isoforms produced by alternative splicing can be identified by analyzing these products. See, for example, the method described in Pykett et al. (1994) Hum. Mol. Genet. 3: 559-64, for details. When a quick and rough analysis of expression pattern is demanded, the present method which uses the PCR of the present invention is particularly preferred, in terms of its high speed, high sensitivity, and simplicity.
[0077] The efficiency of gene expression screening can be improved by using a DNA chip. Here, a DNA chip refers to a miniature array, in which oligonucleotides, DNA clones, or such, are immobilized at a hi

Problems solved by technology

Oral administration of L-DOPA (3,4-dihydroxyphenylalanine) is performed as a primary therapeutic method for Parkinson's disease to compensate for the decrease in the amount of dopamine produced; however, the duration of the effect is known to be unsatisfactory.
However, in addition to cell supply and ethical issues (Rosenstain (1995) Exp. Neurol. 33: 106; Turner et al.
33: 1031-7), this method is currently under criticism for various other problems, including risk of infection and contamination, immunological

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

tion will be explained in more detail with reference to examples, but should not be construed as being limited thereto.

1. Isolation and Sequence Analysis of a Gene Specific to Dopaminergic Neuron Progenitor Cells

[0107] To isolate a gene specific to dopaminergic neuron progenitor cells, the midbrain ventral region of E12.5 mice was additionally cut into two regions in the dorsoventral direction, and genes specifically expressed in the most ventral region containing dopaminergic neurons were identified by the subtraction (N-RDA) method. One of the isolated cDNA fragments was a fragment encoding Lrp4 / Corin. Lrp4 encodes type II transmembrane proteins (FIG. 1).

(1) N-RDA Method

(1)-1. Adapter Preparation

[0108] The following oligonucleotides were annealed to each other, and prepared at 100 μM.

(ad2: ad2S + ad2A, ad3: ad3S + ad3A, ad4: ad4S +ad4A, ad5: ad5S + ad5A, ad13: ad13S + ad13A)ad2S:cagctccacaacctacatcattccgt(SEQ ID NO:5)ad2A:acggaatgatgt(SEQ ID NO:6)ad3S:gtccatcttctctctgagac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Therapeuticaaaaaaaaaa
Login to view more

Abstract

In neuron transplantation therapy, in terms of safety, it is preferable to use a cell population consisting only of a desired type of cells, and to use postmitotic neurons in consideration to avoid the risk of tumorigenesis. Moreover, greater therapeutic effects would be expected through the use of earlier progenitor cells in consideration of post-transplantation viability, proper network formation ability, and such. According to the present invention, Lrp4, a gene that is specifically expressed in dopaminergic neuron proliferative progenitor cells prior to cell cycle exit, was identified. The use of Lrp4 expression in cells as an index allows for the isolation. of cells suitable for transplantation therapy of neurodegenerative diseases such as Parkinson's disease in terms of safety, survival rate, and network formation ability.

Description

TECHNICAL FIELD [0001] Lrp4 is identified as a gene expressed in dopaminergic neuron progenitor cells prior to cell cycle exit. Dopaminergic neuron progenitor cells that can be used in transplantation therapy for neurodegenerative diseases, such as Parkinson's disease (PD), can be efficiently isolated by detecting the expression of this gene or transmembrane proteins encoded by this gene. BACKGROUND ART [0002] The dopamine system is an extremely important system for essential motor regulation, hormone secretion regulation, emotion regulation, and such in the mammalian brain. Thus, abnormalities in dopaminergic neural transmission cause various neural disorders. For example, Parkinson's disease (PD) is a neurodegenerative disease of the extrapyramidal system that occurs due to specific degeneration of dopaminergic neurons in the substantia nigra of the midbrain (Harrison's Principles of Internal Medicine, Vol. 2, 23rd edition, Isselbacher et al., ed., McGraw-Hill Inc., NY (1994), pp....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N5/08A61P25/00C07K16/28C12N5/07C12N5/0797C12N15/09C12P21/08C12Q1/02G01N33/50G01N33/53
CPCC12Q2600/158C12Q1/6883A61P25/00
Inventor ONO, YUICHINAKAGAWA, YASUKOSAKAMOTO, YOSHIMASA
Owner EISIA R&D MANAGEMENT CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products