Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lrp4/corin dopamine-producing neuron proliferation precursor cell marker

a precursor cell and corin dopamine technology, applied in the direction of artificial cell constructs, immunoglobulins against animals/humans, drug compositions, etc., can solve the problems of unsatisfactory effect, risk of infection and contamination, method is currently being criticized, etc., to improve the efficiency of gene expression screening, high sensitivity, and speed

Inactive Publication Date: 2006-10-26
EISIA R&D MANAGEMENT CO LTD
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011] Moreover, the progenitor cells can also be transplanted directly or after having been grown in vitro. The progenitor cells of the present invention also have the potential to differentiate and mature at the optimum location in the brain, as well as the potential to additionally grow in vivo, and can be expected to demonstrate long-term therapeutic effects. In addition, if Lrp4-expressing cells are transplanted after having differentiated and matured in vitro, they can be expected to demonstrate therapeutic effects even if for some reason they do not differentiate into dopaminergic neurons in vivo. In consideration of the risks of tumorigenesis and such, an even higher degree of safety can be expected if cells that have been isolated using a postmitotic neuron marker such as 65B13 after differentiating Lrp4-expressing cells grown in vitro are transplanted. The use of Lrp4-expressing cells for transplantation therapy after being isolated regardless of the method enables a high degree of safety since only the cell type of interest is isolated. In addition, since the earliest progenitor cells can be used, high therapeutic efficacy can be expected in terms of their survival rate, network formation ability, and such. Further, even if the best therapeutic effects cannot be achieved by these early progenitor cells immediately after isolation, since progenitor cells isolated using a marker of the present invention can mature in vitro by culturing or such, materials in the optimum stage of differentiation can be prepared (FIG. 6).
[0077] The efficiency of gene expression screening can be improved by using a DNA chip. Here, a DNA chip refers to a miniature array, in which oligonucleotides, DNA clones, or such, are immobilized at a high density on a support surface, such as glass. For example, in order to carry out multiple expression screening, cDNA clones for each gene of interest, or oligonucleotides specific to each gene, are immobilized on a chip to produce a microarray. Next, RNAs are prepared from dopamine-specific neuron progenitor cells of the present invention, or cells differentiated, induced, or proliferated therefrom, and treated with reverse transcriptase to yield cDNAs. Next, the resulting cDNA sample is labeled with fluorescent tags or other tags, and then hybridized to the microarray. As a result, genes that are actively expressed in the cells have a higher percentage of the total labeled cDNA, while genes that are not significantly expressed have a lower percentage. Namely, the fluorescent signal intensity which represents hybridization between a labeled cDNA and a cDNA clone or an oligonucleotide on the chip, reflects the expression level of each sequence in the labeled cDNA, and thereby enables the quantification of gene expression.

Problems solved by technology

Oral administration of L-DOPA (3,4-dihydroxyphenylalanine) is performed as a primary therapeutic method for Parkinson's disease to compensate for the decrease in the amount of dopamine produced; however, the duration of the effect is known to be unsatisfactory.
However, in addition to cell supply and ethical issues (Rosenstain (1995) Exp. Neurol. 33: 106; Turner et al.
33: 1031-7), this method is currently under criticism for various other problems, including risk of infection and contamination, immunological rejection of transplants (Lopez-Lozano et al.
In these methods, a complex procedure that involves the alteration of cell surface antigens (MHC class I antigens) is required to suppress rejection.
However, none of these contain only dopaminergic neurons or cells that differentiate into dopaminergic cells.
This method requires the complicated step of introducing an exogenous gene, and further, the presence of a reporter gene poses problems of toxicity and immunogenicity when used in conjunction with gene therapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker
  • Lrp4/corin dopamine-producing neuron proliferation precursor cell marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

tion will be explained in more detail with reference to examples, but should not be construed as being limited thereto.

1. Isolation and Sequence Analysis of a Gene Specific to Dopaminergic Neuron Progenitor Cells

[0107] To isolate a gene specific to dopaminergic neuron progenitor cells, the midbrain ventral region of E12.5 mice was additionally cut into two regions in the dorsoventral direction, and genes specifically expressed in the most ventral region containing dopaminergic neurons were identified by the subtraction (N-RDA) method. One of the isolated cDNA fragments was a fragment encoding Lrp4 / Corin. Lrp4 encodes type II transmembrane proteins (FIG. 1).

(1) N-RDA Method

(1)-1. Adapter Preparation

[0108] The following oligonucleotides were annealed to each other, and prepared at 100 μM.

(ad2: ad2S + ad2A, ad3: ad3S + ad3A, ad4: ad4S +ad4A, ad5: ad5S + ad5A, ad13: ad13S + ad13A)ad2S:cagctccacaacctacatcattccgt(SEQ ID NO:5)ad2A:acggaatgatgt(SEQ ID NO:6)ad3S:gtccatcttctctctgagac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Therapeuticaaaaaaaaaa
Login to View More

Abstract

In neuron transplantation therapy, in terms of safety, it is preferable to use a cell population consisting only of a desired type of cells, and to use postmitotic neurons in consideration to avoid the risk of tumorigenesis. Moreover, greater therapeutic effects would be expected through the use of earlier progenitor cells in consideration of post-transplantation viability, proper network formation ability, and such. According to the present invention, Lrp4, a gene that is specifically expressed in dopaminergic neuron proliferative progenitor cells prior to cell cycle exit, was identified. The use of Lrp4 expression in cells as an index allows for the isolation. of cells suitable for transplantation therapy of neurodegenerative diseases such as Parkinson's disease in terms of safety, survival rate, and network formation ability.

Description

TECHNICAL FIELD [0001] Lrp4 is identified as a gene expressed in dopaminergic neuron progenitor cells prior to cell cycle exit. Dopaminergic neuron progenitor cells that can be used in transplantation therapy for neurodegenerative diseases, such as Parkinson's disease (PD), can be efficiently isolated by detecting the expression of this gene or transmembrane proteins encoded by this gene. BACKGROUND ART [0002] The dopamine system is an extremely important system for essential motor regulation, hormone secretion regulation, emotion regulation, and such in the mammalian brain. Thus, abnormalities in dopaminergic neural transmission cause various neural disorders. For example, Parkinson's disease (PD) is a neurodegenerative disease of the extrapyramidal system that occurs due to specific degeneration of dopaminergic neurons in the substantia nigra of the midbrain (Harrison's Principles of Internal Medicine, Vol. 2, 23rd edition, Isselbacher et al., ed., McGraw-Hill Inc., NY (1994), pp....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N5/08A61P25/00C07K16/28C12N5/07C12N5/0797C12N15/09C12P21/08C12Q1/02G01N33/50G01N33/53
CPCC12Q2600/158C12Q1/6883A61P25/00
Inventor ONO, YUICHINAKAGAWA, YASUKOSAKAMOTO, YOSHIMASA
Owner EISIA R&D MANAGEMENT CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products