Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Domestic natural silk gland bioreactor and its construction method

A bioreactor and the technology of the reactor are applied in the field of genetic engineering, which can solve the technical difficulty of silkworm transgenic strains and other problems, and achieve the effect of convenient separation and purification

Inactive Publication Date: 2008-01-23
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the two routes, the technical difficulty of cultivating transgenic strains of silkworm is more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Domestic natural silk gland bioreactor and its construction method
  • Domestic natural silk gland bioreactor and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the PCR clone of sericin 1 gene (ser1 gene) promoter and its signal peptide coding region

[0027] Refer to GeneBand respectively TM / The sequence whose index number is M64781 in the EMBL Data Bank database and the published papers of Garel et al. (Garel A., et al.Insect Biochem.Molec.Biol.1997, 27:469-477), design two primers:

[0028] Primer 1; 5' gaaattcttagctacatctagcccag 3';

[0029] Primer 2: 5' gcatgcctgcaggtgaccgaaagcttttacgc 3';

[0030] Using 200 ng of genomic DNA of silkworm variety 54A (Institute of Sericulture, Chinese Academy of Agricultural Sciences (Jiangsu, Zhenjiang)) as a template, PCR cloned the 5' flanking sequence containing the ser1 gene promoter and the exon 1, endometrium encoding the signal peptide. A DNA fragment containing partial sequences of exon 1 and exon 2; because the fragment is relatively long, the DNA polymerase used is LA Taq (TaKaRa Biotechnology Co., Ltd.);

[0031] The PCR reaction system is as follows:

[0032]...

Embodiment 2

[0036] Example 2, the cloning of the sequence containing the polyA signal site of the sericin 1 gene

[0037] Design the following primers:

[0038] Primer 3: 5′ tctagagggttccagcacaagtggaggagc 3′;

[0039] Primer 4: 5' cgatgacacctcaacggggtgtgag 3';

[0040] The sequence containing the polyA signal site of the sericin 1 gene was amplified by PCR using primers 3 and 4 and using 200ng silkworm 54A genomic DNA as a template.

[0041] The PCR reaction system is as follows:

[0042] 25μl contains: 20pmol each of the corresponding two primers; the final concentration of each dNTP is 0.2mM; template DNA; MgCl 2 Final concentration 1.5mM; 10×PCR reaction buffer 2.5μl; high-fidelity Taq DNA polymerase 1.25U.

[0043] The PCR reaction conditions are:

[0044] Denaturation at 94°C for 5 minutes, 25 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 30 seconds, and extension at 72°C for 10 minutes at the end of the cycle.

[0045] T...

Embodiment 3

[0046] Embodiment 3, the cloning of exogenous target gene-green fluorescent protein egfp gene

[0047] Design the following primers:

[0048] Primer 5: 5'aagcttgtcgacagatctgcatgcatggtgagcaagggcg 3';

[0049] Primer 6: 5' ggtaccggatccttacttgtacagctcgtc 3';

[0050] Using primers 5 and 6, 10 ng of plasmid pEGFP-N1 (Clontech) was used as a template to PCR amplify the green fluorescent protein egfp gene fragment.

[0051] The PCR reaction system is as follows:

[0052] 25μl contains: 20pmol each of the corresponding two primers; the final concentration of each dNTP is 0.2mM; template DNA; MgCl 2 Final concentration 1.5mM; 10×PCR reaction buffer 2.5μl; high-fidelity Taq DNA polymerase 1.25U.

[0053] The PCR reaction conditions are:

[0054] Denaturation at 94°C for 5 minutes, 25 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 30 seconds, and extension at 72°C for 10 minutes at the end of the cycle.

[0055] The resulting...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cultivated silkworm sericin-1 gene promoter and cultivated silkworm silk gland bioreactor drove by signal peptide coding area. It contains setting the promoter, DNA segment, gene, silk gland special excretion plasmid, donor plasmid; transforming DH10Bac.EGT competent cell; extracting recombination virus DNA; loading carrier cell to form recombination virus plasmid; and enlarging virus; injecting cultivated silkworm. The separating and purifying is very convenient; and the cultivated as altitude eukaryote, its silk gland always can be exactly expressed, decorated eukaryon albumen.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a heterologous protein expression system, in particular to a sericin-1 gene promoter and signal peptide coding region to drive exogenous genes in the silk gland of silkworm Silkworm silk gland bioreactor specifically secreted and expressed and its construction method. Background technique [0002] A good heterologous expression system for eukaryotic proteins should have high expression levels, correct modification, folding, and positioning of the expressed eukaryotic proteins, and facilitate downstream purification, among which the problem of purification is the most difficult. Existing expression systems mainly include Escherichia coli expression system, yeast expression system, insect cell-baculovirus expression system, mammalian cell expression system, etc. Among them, Escherichia coli and yeast expression systems can express a large amount of protein and the cost...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/12C12N15/86
Inventor 陆长德郭秀洋
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More