Domestic natural silk gland bioreactor and its construction method
A bioreactor and the technology of the reactor are applied in the field of genetic engineering, which can solve the technical difficulty of silkworm transgenic strains and other problems, and achieve the effect of convenient separation and purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the PCR clone of sericin 1 gene (ser1 gene) promoter and its signal peptide coding region
[0027] Refer to GeneBand respectively TM / The sequence whose index number is M64781 in the EMBL Data Bank database and the published papers of Garel et al. (Garel A., et al.Insect Biochem.Molec.Biol.1997, 27:469-477), design two primers:
[0028] Primer 1; 5' gaaattcttagctacatctagcccag 3';
[0029] Primer 2: 5' gcatgcctgcaggtgaccgaaagcttttacgc 3';
[0030] Using 200 ng of genomic DNA of silkworm variety 54A (Institute of Sericulture, Chinese Academy of Agricultural Sciences (Jiangsu, Zhenjiang)) as a template, PCR cloned the 5' flanking sequence containing the ser1 gene promoter and the exon 1, endometrium encoding the signal peptide. A DNA fragment containing partial sequences of exon 1 and exon 2; because the fragment is relatively long, the DNA polymerase used is LA Taq (TaKaRa Biotechnology Co., Ltd.);
[0031] The PCR reaction system is as follows:
[0032]...
Embodiment 2
[0036] Example 2, the cloning of the sequence containing the polyA signal site of the sericin 1 gene
[0037] Design the following primers:
[0038] Primer 3: 5′ tctagagggttccagcacaagtggaggagc 3′;
[0039] Primer 4: 5' cgatgacacctcaacggggtgtgag 3';
[0040] The sequence containing the polyA signal site of the sericin 1 gene was amplified by PCR using primers 3 and 4 and using 200ng silkworm 54A genomic DNA as a template.
[0041] The PCR reaction system is as follows:
[0042] 25μl contains: 20pmol each of the corresponding two primers; the final concentration of each dNTP is 0.2mM; template DNA; MgCl 2 Final concentration 1.5mM; 10×PCR reaction buffer 2.5μl; high-fidelity Taq DNA polymerase 1.25U.
[0043] The PCR reaction conditions are:
[0044] Denaturation at 94°C for 5 minutes, 25 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 30 seconds, and extension at 72°C for 10 minutes at the end of the cycle.
[0045] T...
Embodiment 3
[0046] Embodiment 3, the cloning of exogenous target gene-green fluorescent protein egfp gene
[0047] Design the following primers:
[0048] Primer 5: 5'aagcttgtcgacagatctgcatgcatggtgagcaagggcg 3';
[0049] Primer 6: 5' ggtaccggatccttacttgtacagctcgtc 3';
[0050] Using primers 5 and 6, 10 ng of plasmid pEGFP-N1 (Clontech) was used as a template to PCR amplify the green fluorescent protein egfp gene fragment.
[0051] The PCR reaction system is as follows:
[0052] 25μl contains: 20pmol each of the corresponding two primers; the final concentration of each dNTP is 0.2mM; template DNA; MgCl 2 Final concentration 1.5mM; 10×PCR reaction buffer 2.5μl; high-fidelity Taq DNA polymerase 1.25U.
[0053] The PCR reaction conditions are:
[0054] Denaturation at 94°C for 5 minutes, 25 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 30 seconds, and extension at 72°C for 10 minutes at the end of the cycle.
[0055] The resulting...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com