Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence

A technology of campylobacter jejuni and nucleotides, applied in biochemical equipment and methods, measurement/testing of microorganisms, resistance to vector-borne diseases, etc., can solve problems such as PCR product contamination, immature technology, non-specific amplification, etc.

Inactive Publication Date: 2008-06-18
TAITAI GENOMICS
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The gene chip method has high detection efficiency, but the technology is immature, the false positive rate and false negative rate are difficult to control, and the cost is high, and it is still in the research stage
Ordinary PCR method is mature in technology and was first used in the detection of food-borne pathogenic bacteria. However, post-processing of PCR products is required, which can easily lead to PCR product contamination, and also has certain non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] 1. Design of primers and probes: Through comparative analysis of all known genome sequences of Campylobacter jejuni, select a segment with no secondary structure and a high degree of conservation (open reading frame C sequence of Campylobacter jejuni,) and design multiple pairs For primers and probes, the length of the primers is generally about 20 bases, and there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0013] Upstream primer CJU: TTGGTATGGCTATAGGAACTCTTATAGCT

[0014] Downstream primer CJR: CACACCTGAAGTATGAAGTGGTCTAAGT

[0015] Probe CJ-p1: ATGGCATATCCTAATTTA

[0016] 2. Establishment and optimization of the reaction system: The target region template used in the establishment and optimization of the reaction system was obtained by the following method: take the standard strain of Campylobacter jejuni and culture it for 48 hours after recovery, take 1ml of the culture solution ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is PCR proliferation primer and probe sequence for detecting nucleotide segment of jejunum campylobacter. The primer sequence includes the primer pair comprising upstream primer sequence CJU of TTGGTATGGCTATAGGAACTCTTATAGCT and downstream primer sequence CJR of CACACCTGAAGTATGAAGTGGTCTAAGT, as well as 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of upstream primer CJU and 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of downstream primer CJR. The probe sequence includes probe CJ-p1 sequence ATGGCATATCCTAATTTA, 10 bases extending in the 3' end direction and 5 bases extending in the 5' end direction.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting nucleotide fragments of campylobacter jejuni. Background technique [0002] Campylobacter jejuni is a common pathogen in imported and exported food, and it is the main pathogen that causes food poisoning and foodborne diseases. The endotoxin of this bacterium can invade the mucosa of the small intestine and large intestine, causing acute enteritis, and can also cause outbreaks of diarrhea or collective food poisoning. The incubation period is generally 3 to 5 days. The pathogenic parts of the human body are the jejunum, ileum, and colon. The main symptoms are diarrhea and abdominal pain, sometimes fever, and occasionally vomiting and dehydration. Bacteria can sometimes enter the bloodstream through the intestinal mucosa and cause sepsis and other organ infections, such as meningitis, arthritis, pyelonephritis, etc. Infection of this bacteria in pregnant women can lead to miscarriage...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCY02A50/30
Inventor 肖性龙林镜中
Owner TAITAI GENOMICS