Exocytosis type expression system pES2c and preparation method

An expression system and extracellular secretion technology, which is applied in the field of prokaryotic extracellular secretion expression vector system and its preparation, can solve the problems of increasing the metabolic burden and toxicity of host bacteria, increasing the biological activity of recombinant proteins, and reducing the effective yield.

Inactive Publication Date: 2009-05-06
ARMY MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Highly expressed recombinant proteins often form inclusion bodies in the cell, resulting in poor biological activity, difficulty in renaturation, reduced effective yield, and increased metabolic burden and toxicity of the host bacteria
Although secretory expression in the periplasmic space can significantly increase the biological activity of recombinant proteins and avoid the cumbersome procedures of inclusion body renaturation, its expression is limited and has strict requirements on the molecular size and structure of recombinant proteins
When the live vector vaccine is inoculated into the body, no matter the bacteria express the recombinant antigen in the cell or the periplasm, the immune system of the body can only contact the recombinant antigen after the bacteria are broken, which reduces the immune efficiency of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exocytosis type expression system pES2c and preparation method
  • Exocytosis type expression system pES2c and preparation method
  • Exocytosis type expression system pES2c and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1: Acquisition and detection of regulatory sequence fragments

[0089] 1. Cloning of the ribosomal terminator sequence rrnBT1

[0090] (1) The primer sequences used to amplify the rrnBT1 terminator sequence are as follows:

[0091] T1 (upstream primer) 5'-TAAACGCCTGGGGTAATGA-3',

[0092] T2 (downstream primer) 5'-GTGTCAGAGGGTTTTCACCGTCATCA-3'.

[0093](2) Using the pQE30 plasmid as a template, mix T1 and T2 in an equimolar ratio and add ddNTP and DNA polymerase, denature at 94°C for 30 seconds, refold at 55°C for 30 seconds, and extend at 72°C for 30 seconds to complete 30 cycles of reaction. The rrnBT1 terminator sequence was added and cloned into pMD18-T. After transformation into competent Escherichia coli, positive clones were screened for ampicillin resistance and blue and white spots, identified by enzyme digestion and sequenced to confirm the correctness of the inserted fragment, and pMD18-rrnBT1 was obtained.

[0094] 2. Obtain the constitutive T5 pro...

Embodiment 2

[0103] Example 2: Cloning and detection of RsaA secretion system functional genes

[0104] 1. The genomic DNA of C. crescentus CB15 was extracted by the classical genomic DNA extraction method.

[0105] 2. According to the rsaAs, rsaD, rsaE, rsaFa, rsaFb gene sequences published by GenBank, design the following primers:

[0106] p1: 5'-GCCTTCGGCGCTGCGGTCACCCTGGGC-3';

[0107] p2: 5'-GCGATCCTCGCCTAGGCGAGGATCAGACGTTC-3';

[0108] p3: 5'-GCTACGCGCTGGCCGGCCTTGCCTAG-3';

[0109] p4: 5'-TTACTGGACGCGCTGCAACGGCGCGGG-3';

[0110] p5; 5'-ATGTTCAAGCGCAGCGGCGCGAAGCCGACG-3;

[0111] p6;5'-CTACTCCTAGCGCATCGTGGTGCGCAGG-3

[0112] p7: 5'GCTAGCATGCGAGTGCTGTCGAAAGTTCTGTCCGTG, containing NheI restriction site.

[0113] p8: 5'TCTAGAAATTCAGCTCCGTCGGCAAAGCGCCGCGG, containing XbaI restriction site.

[0114] p9: 5'TCTAGAATGTTGATGTCGAACCGTCGACGGG, containing XbaI restriction site.

[0115] p10: 5'AAGCTTAATCTATTTCGAGCCGCTCGGGGGCTT, containing HindIII restriction site.

[0116] 3. P1 and p2, p3...

Embodiment 3

[0119] Example 3: Construction and detection of secreted expression vector system

[0120] 1.p-p T5 -ESD-rsaD and p-P T5 -ESD-rsaFa recombinant plasmids were double digested respectively, and the downstream rrnBTI terminator sequence was removed.

[0121] 2. Digest p-P respectively T5 -ESD-rsaE and p-P T5 - ESD-rsaFb, fragments Epsilon-SD-rsaE-rrnBT1 and Epsilon-SD-rsaFb-rrnBT1 were obtained.

[0122] 3. The DNA fragments obtained by enzyme digestion were respectively combined with p-P with the downstream rrnBT1 terminator removed T5 -ESD-rsaD and p-P T5 -ESD-rsaFa connection, transformation into E.coli JM109, enzyme digestion identification, and recombinant plasmid p-P T5 -ESD-rsaD-rsaE and p-P T5 -ESD-rsaFaFb.

[0123] 4. Insert the rsaAs gene fragment into the downstream multiple cloning site of the GFP gene in the pAcGFP plasmid, fuse the GFP gene and the rsaAs signal sequence in frame, transform E.coli JM109, identify and sequence the recombinant plasmid pAcGFP-rsaA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention discloses a method for preparing extracellular-secretion expression system pES2c. This invention utilizes DNA operation technique to obtain required functional genes and regulating sequence of RsaA secretion system, and inserts them into compatible plasmids pQE / pBIOEx according to wild-type arrangement order of RsaA secretion system to construct the prokaryotic extracellular-secretion expression vector system pES2c, which can be used as a functional RsaA secretion machine after expression in common host bacteria such as Escherichia coli, and has such advantages as high productivity, high bioavailability, high activity, low cost, easy operation and high controllability.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a prokaryotic extracellular secretion type expression vector system capable of presenting a complete and functional RsaA secretion machine when expressed in common host bacteria such as Escherichia coli (E.coli) and a preparation method thereof Background technique [0002] In life science research and production of biopharmaceuticals and biological products, the preparation of recombinant proteins using expression vectors is an important and critical link. Obtaining a sufficient amount of biologically active recombinant protein is a necessary condition for subsequent research and production. Utilizing most of the existing expression vectors, the recombinant protein is expressed in the intracellular or periplasmic space rather than the extracellular environment, which brings insurmountable problems to the effective expression and utilization of the recombinant ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/09C12N15/70C12N15/31C12N15/65
Inventor 宁亚蕾邹全明周立雄毛旭虎郭刚杨珺肖洁张卫军
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap