Exocytosis type expression system pES2c and preparation method
An expression system and extracellular secretion technology, which is applied in the field of prokaryotic extracellular secretion expression vector system and its preparation, can solve the problems of increasing the metabolic burden and toxicity of host bacteria, increasing the biological activity of recombinant proteins, and reducing the effective yield.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Example 1: Acquisition and detection of regulatory sequence fragments
[0089] 1. Cloning of the ribosomal terminator sequence rrnBT1
[0090] (1) The primer sequences used to amplify the rrnBT1 terminator sequence are as follows:
[0091] T1 (upstream primer) 5'-TAAACGCCTGGGGTAATGA-3',
[0092] T2 (downstream primer) 5'-GTGTCAGAGGGTTTTCACCGTCATCA-3'.
[0093](2) Using the pQE30 plasmid as a template, mix T1 and T2 in an equimolar ratio and add ddNTP and DNA polymerase, denature at 94°C for 30 seconds, refold at 55°C for 30 seconds, and extend at 72°C for 30 seconds to complete 30 cycles of reaction. The rrnBT1 terminator sequence was added and cloned into pMD18-T. After transformation into competent Escherichia coli, positive clones were screened for ampicillin resistance and blue and white spots, identified by enzyme digestion and sequenced to confirm the correctness of the inserted fragment, and pMD18-rrnBT1 was obtained.
[0094] 2. Obtain the constitutive T5 pro...
Embodiment 2
[0103] Example 2: Cloning and detection of RsaA secretion system functional genes
[0104] 1. The genomic DNA of C. crescentus CB15 was extracted by the classical genomic DNA extraction method.
[0105] 2. According to the rsaAs, rsaD, rsaE, rsaFa, rsaFb gene sequences published by GenBank, design the following primers:
[0106] p1: 5'-GCCTTCGGCGCTGCGGTCACCCTGGGC-3';
[0107] p2: 5'-GCGATCCTCGCCTAGGCGAGGATCAGACGTTC-3';
[0108] p3: 5'-GCTACGCGCTGGCCGGCCTTGCCTAG-3';
[0109] p4: 5'-TTACTGGACGCGCTGCAACGGCGCGGG-3';
[0110] p5; 5'-ATGTTCAAGCGCAGCGGCGCGAAGCCGACG-3;
[0111] p6;5'-CTACTCCTAGCGCATCGTGGTGCGCAGG-3
[0112] p7: 5'GCTAGCATGCGAGTGCTGTCGAAAGTTCTGTCCGTG, containing NheI restriction site.
[0113] p8: 5'TCTAGAAATTCAGCTCCGTCGGCAAAGCGCCGCGG, containing XbaI restriction site.
[0114] p9: 5'TCTAGAATGTTGATGTCGAACCGTCGACGGG, containing XbaI restriction site.
[0115] p10: 5'AAGCTTAATCTATTTCGAGCCGCTCGGGGGCTT, containing HindIII restriction site.
[0116] 3. P1 and p2, p3...
Embodiment 3
[0119] Example 3: Construction and detection of secreted expression vector system
[0120] 1.p-p T5 -ESD-rsaD and p-P T5 -ESD-rsaFa recombinant plasmids were double digested respectively, and the downstream rrnBTI terminator sequence was removed.
[0121] 2. Digest p-P respectively T5 -ESD-rsaE and p-P T5 - ESD-rsaFb, fragments Epsilon-SD-rsaE-rrnBT1 and Epsilon-SD-rsaFb-rrnBT1 were obtained.
[0122] 3. The DNA fragments obtained by enzyme digestion were respectively combined with p-P with the downstream rrnBT1 terminator removed T5 -ESD-rsaD and p-P T5 -ESD-rsaFa connection, transformation into E.coli JM109, enzyme digestion identification, and recombinant plasmid p-P T5 -ESD-rsaD-rsaE and p-P T5 -ESD-rsaFaFb.
[0123] 4. Insert the rsaAs gene fragment into the downstream multiple cloning site of the GFP gene in the pAcGFP plasmid, fuse the GFP gene and the rsaAs signal sequence in frame, transform E.coli JM109, identify and sequence the recombinant plasmid pAcGFP-rsaA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 