Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction of isovalerylspiramycin I gene engineering strain

A technology of isovalerylspiramycin and genetically engineered strains, which is applied in the fields of genetic engineering, plant genetic improvement, biochemical equipment and methods, etc., to achieve the effect of reducing energy consumption

Inactive Publication Date: 2007-10-17
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, only the strains that produce isovalerylspiramycin I as the main component have not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of isovalerylspiramycin I gene engineering strain
  • Construction of isovalerylspiramycin I gene engineering strain
  • Construction of isovalerylspiramycin I gene engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Construction of recombinant vector pKCL1-4

[0034] According to the 3-O-acyltransferase gene and its flanking sequence [NCBIDQ642742] obtained by our laboratory, two pairs of primers were designed and inserted into the corresponding restriction sites (the relative positions of the primers on the chromosome are shown in Figure 1):

[0035] L1 upstream primer (a) GCG AAGCTT TGCCCTGGCAATTGCAGTGTCAG HindIII

[0036] Downstream primer (b) GCG TCTAGA GCCGAACGTGACGATGTGCAGCG XbaI

[0037] L2 Upstream Primer (c)GTC TCTAGA CAGTGGTCCTTCGCCTTCTATCT XbaI

[0038] Downstream primer (d)GAC GGATCC TCGTCGCGCAGCAGGTCGTTGAG BamHI

[0039] Conventional PCR amplification was performed to obtain a fragment homologous to two parts of the 3-O-acyltransferase gene (left arm L 1 , 1.0kb; right arm L 2 , 1.0kb). Both ends of L1 carry HindIII and XbaI restriction sites, and both ends of L2 carry XbaI and BamHI sites. Will L 1 , L 2 The fragment was ligated with the thermosens...

Embodiment 2

[0040] Construction of the genetically engineered strain of Bitespiramycin 3-O-acyltransferase gene disruption

[0041] Bitespiramycin-producing bacteria were cultured at 28°C for 7-10 days on slant medium [Wang Yiguang et al., Acta Biological Engineering, 1992 8(1): 1-14], according to the literature [D.A.Hopwood et al. Geneticmanipulation of Streptomyces, A The method described in Laboratory Manual, Norwich; JohnInnesFoundation UK, 1985] prepared protoplasts, and pKCL1-4 was introduced into the Bitespiramycin producing bacteria through the protoplast transformation method, and Am resistance was used as a selectable marker to obtain transformants; The non-resistant plate was cultured and subcultured at 37°C, and a single colony was isolated to obtain an Am-sensitive strain (called BT3-O-ATΔ strain).

[0042] The genomic DNA of the mutant strain and the original strain were extracted as templates, and primers a and d were paired for PCR amplification and electrophoresis ident...

Embodiment 3

[0043] HPLC detection of the fermentation product of the genetically engineered strain of Bitespiramycin 3-O-acyltransferase gene disruption

[0044] The fermentation and preliminary extraction of the BT3-O-ATΔ mutant strain were carried out according to the literature [Wang Yiguang et al., Acta Bioengineering, 1992, 8(1): 1-14]. After the initial extract of the fermentation broth was evaporated to dryness, it was dissolved in a small amount of methanol, and the Shimadzu LC-10ATvp liquid chromatograph was used, with a second tube array detector, and the chromatographic column was Kromasil C184. Sodium hydrogen solution (53 / 47), the flow rate is 1mL / min. With bitspiramycin pure product as contrast, take the retention time of bitspiramycin main component as standard [Chinese Journal of Antibiotics such as Jiang Wei. 2002,27 (7): 387-391], get 5ul fermented liquid, The initially extracted samples were tested by HPLC. The HPLC quantitative analysis results of the proportion of m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to use of gene engineering in modifying antibiotic ingredient, more specificly it refer to blocking and destroying 3-O-acyltransferase which take part in the production of component II and III of bitespiramycin-producing bacteria. The engineered bacteria is obtained by homologous gene double exchange and employs 4'' -isovalerylspiramycin I as main ingredient. The engineered bacteria can simplify the production process, lower the production cost and control the quality standard.

Description

Technical field: [0001] The invention relates to the application of genetic engineering technology in transforming antibiotic components. Background technique: [0002] Isovalerylspiramycin I is a component produced by the Bitespiramycin (formerly known as Shengjimycin) producing bacteria constructed by our research laboratory using genetic engineering technology ["Manufacturing method of Shengjimycin", patent No.: ZL97104440.6], ["Acquisition of High-Producing Bitespiramycin Strains", Patent No.: ZL 02148771.5]. Bitespiramycin is about to complete Phase III clinical trials. The experimental results show that it has good clinical efficacy and safety in the treatment of respiratory tract infections and other diseases. [0003] In addition to the isovalerylspiramycin I component, the finished product of bitspiramycin also contains isovaleryl II and III components, and also contains a small amount of derivatives of 4” butyryl, propionyl, acetyl and a small amount of Spiramyc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/00C12N15/54C12N15/09C12P19/62
Inventor 武临专王以光马春燕赫卫清周红霞
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com