Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same

A technology of genetically engineered bacteria and recombinant plasmids, applied in the field of bio-fermentation to synthesize glutathione, can solve the problems of high-density cultivation of brewer's yeast, reduce fermentation quality, increase fermentation cost, etc., to facilitate large-scale industrial production, reduce cost effect

Inactive Publication Date: 2008-07-23
SHANGHAI INST OF PHARMA IND CO LTD
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during the fermentation process of beer yeast, the ethanol produced will inhibit the growth of beer yeast, which makes it difficult to cultivate beer yeast at high density, that is, beer yeast cannot grow at a very high density, and the long fermentation period reduces the fermentation quality. Increased fermentation cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same
  • Pichia yeast genetic engineering bacteria for producing glutathione and recombinant plasmid used for constructing the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The acquisition and preservation of embodiment 1 brewer's yeast gshI and gshII genes

[0021] 1) Primers were designed with the GSH1 and GSH2 gene sequences of S. cerevisiae from the NCBI GenBank database. The 5' ends of the upstream primers in the two pairs of primers both contained Kozark sequences and added a Cla I restriction site (underlined) at the 5' ends. ), a Not I restriction site (underlined) is added to the 5' end of the downstream primer; the gshI upstream and downstream primers are respectively:

[0022] CC ATCGAT ACCATGGGACTCTTAGCTTTG

[0023] G CGGCCG CTTAACATTTGCTTTCTAT,

[0024] The gshII upstream and downstream primers are:

[0025] CC ATCGAT ACCATGGCACACTATCCA

[0026] G CGGCCG CCCTAGTAAAGAATAATACTG.

[0027] 2) Obtain gshI and gshII by PCR

[0028] Use Saccharomyces cerevisiae y10 as a template and amplify the product with Taq enzyme. The PCR conditions are: ① 97°C for 5 minutes, ② Pause, ③ 94°C for 30 seconds, ④ 58°C for 1 minute, ⑤ 72...

Embodiment 2

[0034] Example 2 Construction of plasmid His4-pGAPZαA

[0035] 1) Design primers to obtain a His4-containing fragment by PCR using plasmid pAO815 as a template. Its upstream primer starts from the plasmid BamH I site (underlined) and adds a protective base at the 5' end; the downstream primer 5' end adds the restriction site Bgl II (underlined) with the same tail as BamH I, and adds The upper protective base; the upper and lower primers are respectively:

[0036] GC GGATCC TAATGCGGTAGTTTATCACAGTTA and

[0037] GA AGATCT TCATGACATTTCCCTTGCTACCTG.

[0038] 2) The His4 fragment was obtained by PCR amplification with Taq enzyme [TaKaRa]. PCR conditions: ①97°C for 5 min, ②pause, ③94°C for 30 sec, ④59.6°C for 1 min, ⑤72°C for 3.5 min, ⑥repeat ③~⑤ for a total of 29 cycles, ⑦72°C for 10 min, ⑧4°C hold.

[0039] 3) The PCR product was digested with BamH I and Bgl II and recovered from the gel, pGAPZαA was digested with BamHI and the fragment was recovered from the gel;

[0040...

Embodiment 3

[0043] Construction of embodiment 3 plasmid G2P

[0044] 1) PMD18T-gshII was double-digested with Cla I and Not I to recover the gshII-containing fragment gshII / ClaI Not I; a large number of NspV and Not I double-digested plasmid pGAPZαA was recovered to recover a large fragment pGAPZαA / NspVNot I;

[0045] 2) Ligate the above-mentioned fragment gshII / ClaINotI with pGAPZαA / NspVNotI and transform it into E.coliDH5α (for the transformation method, refer to the purchased competent cell manual), and finally spread the transformed bacteria solution on 25 μg / ml Zeocin TM On a low-salt LB agar plate, wait for a single colony to form at 37°C for 12-16 hours, extract the plasmid, and identify it by single-enzyme digestion with Bln I. The electrophoresis diagram of the correct plasmid restriction enzyme digestion shows two bands of 462bp and 3846bp to preserve the positive bacterial glycerol tube.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a pichia genetic engineering bacteria used for generating the glutathione and a recombinant plasmid used for constructing the pichia genetic engineering bacteria, which is characterized in that: the enzyme system GSH I and GSH II genes synthesized through the exogenous glutathione are respectively put in the promoter such as the CAP promoter, and integrated to the methanol yeast under the regulation of the GAP promoter, so as to obtain the high yield GSH genetic engineering bacteria. The pichia genetic engineering bacteria used for generating the glutathione and a recombinant plasmid used for constructing the pichia genetic engineering bacteria has the advantages that: the pichia genetic engineering bacteria can be carried out high density cultivation, so as to decrease the cost of producing the GSH and be beneficial to large scale industrial production.

Description

technical field [0001] The invention relates to the field of glutathione synthesis by biological fermentation, in particular to a Pichia pastoris genetically engineered bacterium producing glutathione and a recombinant plasmid used to construct it. Background technique [0002] Glutathione (GSH) is widely involved in the research fields of enzymology, transport, pharmacology, toxicology, therapy, endocrinology, microbiology and agriculture because of its various physiological functions, especially in the pharmaceutical and food industries. Big. Since the 1980s, fermentation has been the main method for industrial production of glutathione. [0003] At present, the synthesis of glutathione by biological fermentation is mainly based on the fermentation of Saccharomyces cerevisiae. Studies have shown that the biosynthesis of glutathione includes γ-glutamylcysteine ​​synthetase (GSH I, EC6.3.2.2) and glutathione synthase (GSH II, EC6.3.2.3) The composed glutathione synthetase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N1/19
Inventor 陈少欣费理文史炳照
Owner SHANGHAI INST OF PHARMA IND CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap