Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof
A technology for rapid diagnosis of Mycobacterium tuberculosis, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, etc., can solve the problems of rapid diagnosis kits of genes without Mycobacterium tuberculosis, and achieve significant color difference and verification  The effect of high efficiency and high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Examples
Embodiment 1
[0036] The preparation of embodiment 1 kit
[0037] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0038] Outer primer F3: GGCTGGTCTCTGGCGTT, as shown in SEQ ID NO: 1;
[0039] Outer primer B3: GGCCTATACAAGACCGAGCT, as shown in SEQ ID NO: 2;
[0040]Internal primer FIP: GCCTCTACCAGTACTGCGGCTTTTGAGCGTAGTAGGCAGCCT, as shown in SEQ ID NO: 3;
[0041] Internal primer BIP: GTTGAACCAGTCGACCCAGCGTTTTAACCCGGCAAGCCCT, as shown in SEQ ID NO: 4;
[0042] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container.
[0043] (3) Prepare the reaction solution: the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, and internal primer FIP per 1L 2 mol of each BIP and 0.25 mol of each outer primer F3 / B3 were prepared and placed in a container.
Embodiment 2
[0056] The preparation of embodiment 2 kit
[0057] The reaction solution contains 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer per 1L Prepare 0.2mol each of F3 / B3 and place in the container.
[0058] Lysis solution 1 contains 20mmol of Tris-HCl with pH8.3, 100mmol of KCl, 5mmol of MgCl per 1L 2 , 10ml Triton X-100, 10ml Tween-20 and 0.2g gelatin preparation.
[0059] The chromogenic solution is EvaGreen.
[0060] Others are the same as embodiment 1.
Embodiment 3
[0061] Example 3 Application of Mycobacterium tuberculosis Gene Rapid Diagnostic Kit
[0062] 1. Sample processing (template DNA extraction)
[0063] (1) Take 1-2ml of sputum sample, add an equal volume of 4 mass% NaOH solution, vortex and mix well, make the two fully contact, let stand for 30 minutes until fully liquefied without sputum, draw 0.5mL of liquefied sample into Eppendorf tube Centrifuge at 10000r / min for 5 minutes, discard the supernatant, and add 1mL of normal saline to the precipitate. Shake to wash the precipitate and then centrifuge at 10000r / min for 5 minutes. Do this twice, discard the supernatant, and collect the precipitate;
[0064] (2) Add 0.5 μl of lysis solution 2 to 50 μl of lysis solution 1 to prepare a sample lysis solution, add it to the above precipitate, and react in a water bath at 60°C for 1 hour, boil for 15 minutes to terminate the reaction, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is Sample template DNA.
[0065] 2. Th...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com