Mycobacterium tuberculosis gene rapid diagnosis reagent kit base on loop-mediated isothermal amplification technology and detection method thereof

A technology for rapid diagnosis of Mycobacterium tuberculosis, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, etc., can solve the problems of rapid diagnosis kits of genes without Mycobacterium tuberculosis, and achieve significant color difference and verification The effect of high efficiency and high yield

Inactive Publication Date: 2008-11-12
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isotherma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The preparation of embodiment 1 kit

[0037] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0038] Outer primer F3: GGCTGGTCTCTGGCGTT, as shown in SEQ ID NO: 1;

[0039] Outer primer B3: GGCCTATACAAGACCGAGCT, as shown in SEQ ID NO: 2;

[0040]Internal primer FIP: GCCTCTACCAGTACTGCGGCTTTTGAGCGTAGTAGGCAGCCT, as shown in SEQ ID NO: 3;

[0041] Internal primer BIP: GTTGAACCAGTCGACCCAGCGTTTTAACCCGGCAAGCCCT, as shown in SEQ ID NO: 4;

[0042] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container.

[0043] (3) Prepare the reaction solution: the reaction solution contains 2mmol dNTP, 25mmol Tris-Cl, 12.5mmol potassium chloride, 12.5mmol ammonium sulfate, 10mmol magnesium sulfate, 1.25ml TritonX-100, 1mol betaine, and internal primer FIP per 1L 2 mol of each BIP and 0.25 mol of each outer primer F3 / B3 were prepared and placed in a container.

[0044] (4) Preparation of Lysis Solution 1: Lysis So...

Embodiment 2

[0056] The preparation of embodiment 2 kit

[0057] The reaction solution contains 1.6mmol dNTP, 20mmol Tris-Cl, 10mmol potassium chloride, 10mmol ammonium sulfate, 8mmol magnesium sulfate, 1ml TritonX-100, 0.8mol betaine, 1.6mol each of internal primer FIP / BIP and external primer per 1L Prepare 0.2mol each of F3 / B3 and place in the container.

[0058] Lysis solution 1 contains 20mmol of Tris-HCl with pH8.3, 100mmol of KCl, 5mmol of MgCl per 1L 2 , 10ml Triton X-100, 10ml Tween-20 and 0.2g gelatin preparation.

[0059] The chromogenic solution is EvaGreen.

[0060] Others are the same as embodiment 1.

Embodiment 3

[0061] Example 3 Application of Mycobacterium tuberculosis Gene Rapid Diagnostic Kit

[0062] 1. Sample processing (template DNA extraction)

[0063] (1) Take 1-2ml of sputum sample, add an equal volume of 4 mass% NaOH solution, vortex and mix well, make the two fully contact, let stand for 30 minutes until fully liquefied without sputum, draw 0.5mL of liquefied sample into Eppendorf tube Centrifuge at 10000r / min for 5 minutes, discard the supernatant, and add 1mL of normal saline to the precipitate. Shake to wash the precipitate and then centrifuge at 10000r / min for 5 minutes. Do this twice, discard the supernatant, and collect the precipitate;

[0064] (2) Add 0.5 μl of lysis solution 2 to 50 μl of lysis solution 1 to prepare a sample lysis solution, add it to the above precipitate, and react in a water bath at 60°C for 1 hour, boil for 15 minutes to terminate the reaction, centrifuge at 10,000 rpm for 2 minutes, and the supernatant is Sample template DNA.

[0065] 2. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a gene fast diagnostic reagent kit for Mycobacterium tuberculosis based on a loop-mediated isothermal amplification technology and a detection method thereof, wherein, the reagent kit consists of two pairs of primers, DNA polymerase, reaction liquid, lysate 1, lysate 2, stabilizing liquid, chromogenic solution and positive control liquid, and the eight liquids are respectively placed in containers. The gene fast diagnostic reagent kit uses six sections and four primers, and can judge whether a target substance exists according to the condition of the augmentation, so the gene fast diagnostic reagent kit has high specificity; the gene fast diagnostic reagent kit is quick and efficient, has high sensitivity, can perform the augmentation reaction only with a constant temperature, and does not need special reagent and equipment; the gene fast diagnostic reagent kit has simple and convenient identification, pyrophosphate ions precipitated from dNTP are combined with Mg<2+> in reaction solution to produce a byproduct, namely magnesium pyrophosphate precipitate, the reaction can be identified through the observation of naked eyes, and positive and negative results have a remarkable chromogenic difference when the chromogenic solution is added, thereby being more apparent and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit of mycobacterium tuberculosis gene based on a loop-mediated isothermal amplification technique and a detection method thereof. Background technique [0002] At present, there are many detection methods for Mycobacterium tuberculosis, ranging from the national standard (GB / T4789.7-2003) focusing on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification, to the immunological detection technology of specific proteins, nucleic acid Molecular biological detection methods such as probes and polymerase chain reaction (PCR) technology [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/04C12Q1/68
Inventor 曹以诚石磊杜正平陈洵赵长臣谭惠媚刘妙琴李心晖
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap