Check patentability & draft patents in minutes with Patsnap Eureka AI!

Deoxyhydroxylputrescinelysine synthase code gene and antisense base sequences thereof

An antisense nucleotide and nucleotide sequence technology, applied in the field of deoxyhydroxyputrescine lysine synthase coding gene and its inhibition of gene expression, can solve crop yield reduction, global food and ecological crisis, and affect crop growth conditions and other issues to achieve the effect of increasing production and reducing costs

Inactive Publication Date: 2012-06-13
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Various environmental stresses will seriously affect the growth of crops, resulting in reduced crop yields and triggering global food and ecological crises

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deoxyhydroxylputrescinelysine synthase code gene and antisense base sequences thereof
  • Deoxyhydroxylputrescinelysine synthase code gene and antisense base sequences thereof
  • Deoxyhydroxylputrescinelysine synthase code gene and antisense base sequences thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, the separation of deoxyhydroxyputrescine lysine synthase coding gene DHS cDNA sequence

[0045]The full-length cDNA sequence of the gene DHS encoding deoxyhydroxyputrescine lysine synthase was obtained by reverse transcription PCR (RT-PCR) combined with rapid amplification of cDNA ends (RACE). Specifically, the first strand of cDNA was synthesized by reverse transcription using the total RNA derived from the leaves of Nicotiana benthamiana as a template; Primers were designed to amplify the conserved region of the homologous gene of Nicotiana tabaccum, and a 868bp DHS cDNA fragment was obtained. Then, forward and reverse primers were designed inside this fragment, and the 3' and 5' end sequences of cDNA were respectively obtained by RACE method, and then the full-length gene was cloned by RT-PCR method.

[0046] 1. Total RNA extraction

[0047] TRIzol (Invitrogen) was used to extract total RNA from senescent leaves of Nicotiana benthamiana (National Germ...

Embodiment 2

[0061] Embodiment 2, Tobacco Stress Resistance Improvement Experiment

[0062] 1. Construction of plant expression recombinant vector pAND

[0063] Using the T-NbDHS plasmid as a template, use the primer DHS5': GAGCTC CTCATAAAATGCCTTGCACC (SacI site introduced) and DHS3': TCTAGA ACCATTTCGCATCATATTG (XbaI site introduced) was used for PCR amplification to obtain a 516bp DHS cDNA fragment, which was ligated with the pGEM-T Easy vector to obtain a T-NbDHS-1 vector, which was introduced into Escherichia coli competent, and the plasmid was extracted after identification. After the plasmid was digested with XbaI and SacI, it was detected by electrophoresis, and the results were as follows: figure 2 As shown, it shows that the bands of 3.0kb and 516bp are cut out, the fragment of 516bp is recovered, and then sequenced. .

[0064] The plant expression vector pBI121 contains the cauliflower mosaic virus 35S promoter (CaMV35S promoter) and the Agrobacterium nopaline synthase gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an encoding gene of deoxyhypusine synthase and a method for inhibiting expression of the gene and a special antisense nucleotide sequence thereof. The deoxyhypusine synthase of the invention is selected from (a) or (b): (a) a protein which consists of amino acid sequence showed in sequence 4 of the sequence table; (b) a protein which is derived from (a) by substituting and / or deleting and / or adding one or more than one amino acid residue of the amino acid sequence showed in sequence 4 of the sequence table, and encodes the deoxyhypusine synthase. The invention uses antisense nucleotide sequence of DHS to inhibit normal expression of plant endogenous DHS gene, thereby the invention improves the resistance capability of plants against different stress environments, such as drought resistance, low temperature tolerance and salt tolerance. Each resistance is significantly higher than the negative control and the resistances are improved at the same time. Therefore,the encoding gene of the deoxyhypusine synthase and the antisense nucleotide sequence thereof and the method thereof have important significance on improving crop yield.

Description

technical field [0001] The present invention relates to the coding gene of deoxy putrescine lysine synthase and its antisense nucleotide sequence, in particular to the coding gene of deoxy putrescine lysine synthase, the method for inhibiting the expression of the gene and the special antisense nucleoside acid sequence. Background technique [0002] The growth and development of plants are greatly affected by the environment. All kinds of environmental stress will seriously affect the growth of crops, resulting in crop yield reduction, leading to global food and ecological crisis. In today's global shortage of food supply, it is especially necessary to improve the resistance of crops to overcome various adverse environments, such as low temperature, high temperature, drought, and salinity, so as to increase crop yields to alleviate food pressure. [0003] With the development of molecular biology, people have been able to understand the mechanism of plant tolerance (resist...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/11A01H1/00A01H5/00C12N15/113
Inventor 王宏芝魏建华王彦珍李瑞芬马荣才
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More