Deoxyhydroxylputrescinelysine synthase code gene and antisense base sequences thereof
An antisense nucleotide and nucleotide sequence technology, applied in the field of deoxyhydroxyputrescine lysine synthase coding gene and its inhibition of gene expression, can solve crop yield reduction, global food and ecological crisis, and affect crop growth conditions and other issues to achieve the effect of increasing production and reducing costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1, the separation of deoxyhydroxyputrescine lysine synthase coding gene DHS cDNA sequence
[0045]The full-length cDNA sequence of the gene DHS encoding deoxyhydroxyputrescine lysine synthase was obtained by reverse transcription PCR (RT-PCR) combined with rapid amplification of cDNA ends (RACE). Specifically, the first strand of cDNA was synthesized by reverse transcription using the total RNA derived from the leaves of Nicotiana benthamiana as a template; Primers were designed to amplify the conserved region of the homologous gene of Nicotiana tabaccum, and a 868bp DHS cDNA fragment was obtained. Then, forward and reverse primers were designed inside this fragment, and the 3' and 5' end sequences of cDNA were respectively obtained by RACE method, and then the full-length gene was cloned by RT-PCR method.
[0046] 1. Total RNA extraction
[0047] TRIzol (Invitrogen) was used to extract total RNA from senescent leaves of Nicotiana benthamiana (National Germ...
Embodiment 2
[0061] Embodiment 2, Tobacco Stress Resistance Improvement Experiment
[0062] 1. Construction of plant expression recombinant vector pAND
[0063] Using the T-NbDHS plasmid as a template, use the primer DHS5': GAGCTC CTCATAAAATGCCTTGCACC (SacI site introduced) and DHS3': TCTAGA ACCATTTCGCATCATATTG (XbaI site introduced) was used for PCR amplification to obtain a 516bp DHS cDNA fragment, which was ligated with the pGEM-T Easy vector to obtain a T-NbDHS-1 vector, which was introduced into Escherichia coli competent, and the plasmid was extracted after identification. After the plasmid was digested with XbaI and SacI, it was detected by electrophoresis, and the results were as follows: figure 2 As shown, it shows that the bands of 3.0kb and 516bp are cut out, the fragment of 516bp is recovered, and then sequenced. .
[0064] The plant expression vector pBI121 contains the cauliflower mosaic virus 35S promoter (CaMV35S promoter) and the Agrobacterium nopaline synthase gene...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 