Polypeptide of fungal ubuquitin-conjugating enzyme, coding sequence thereof and preparation method and application
A technology of cross-linking enzymes and sequences, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Cloning and sequencing of the cDNA of the ubiquitin cross-linking enzyme of Populus edulis: A new cDNA sequence was obtained in this example, which has not been reported before.
[0045] 1. Primer amplification
[0046]Using the total RNA of Poplaria arborii as a template, use oligonucleotide A: 5'gac cac gcg tat cga tgt cga ct16(a / c / g)3' as a reverse transcription primer to perform reverse transcription to obtain the first strand of cDNA, Using oligonucleotide B: 5'atggggtctgtatccgcaagac3' as forward primer, oligonucleotide C: 5'gac cac gcg tat cga tgt cga c3' as reverse primer, perform PCR, and the PCR condition is 95°C for 10 minutes, Enter three-step cycle (95°C for 1min, 53°C for 1min, 72°C for 2min, a total of 30 cycles), and finally extend at 72°C for 10min. 20μL reaction system contains: 1μg cDNA, 0.2mM dNTP, 20pM forward primer and reverse primer, 2μL 10×buffer, 1μL Taq enzyme and 1.5mM MgCl 2 . The PCR product is a 600bp target fragment.
[0047] 2. Clonin...
Embodiment 2
[0051] Expression and purification of poplar mushroom ubiquitin cross-linking enzyme in Escherichia coli: In this example, a large number of expressed and purified protein samples can be obtained.
[0052] First, design upstream and downstream primers containing Nco I and Xho I restriction sites, and use the plasmid pGEM-Agaricus poplarus ubiquitin crosslinking enzyme as a template to perform PCR to obtain PCRs containing Nco I and Xho I restriction sites at both ends The product, the PCR product and pET28b plasmid were digested with Nco I and Xho I enzymes respectively, and the ubiquitin cross-linking enzyme fragment and the target plasmid were recovered, and the ligation reaction was carried out according to the recovered amount to construct the prokaryotic expression vector pET28b-Arbusculus ubiquitin Cross-linking enzyme (Pet28b-UBC), such as figure 1 shown.
[0053] According to the aforementioned prokaryotic expression method, according to the results of inducing and ex...
Embodiment 3
[0055] Preparation and activity determination of the truncated body of the ubiquitin cross-linking enzyme (ΔUBC) of the poplar mushroom: In this example, a large amount of expressed and purified truncated body of the ubiquitin cross-linking enzyme of the poplar mushroom (ΔUBC) (N-terminal truncated by 30 amino acids, C-terminal truncated 21 amino acids), the sample retained most of the anti-tumor activity and enzyme activity.
[0056] Design the 3' primer containing the Nco I restriction site with the 63-84th nucleic acid of the coding nucleic acid sequence, and design the 5' primer containing the stop codon and the Xho I restriction site with the 406-423rd nucleic acid of the coding nucleic acid sequence Primers, using the plasmid pGEM-poplar mushroom ubiquitin cross-linking enzyme (pGEM-UBC) as a template, PCR amplification to obtain PCR products containing Nco I and Xho I restriction sites at both ends, using Nco I and Xho I enzymes The PCR product and the pET28b plasmid we...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More