Novel compounds and methods for their production

A compound, representative technology, applied in the field of producing these compounds, can solve the problem of reducing

Inactive Publication Date: 2009-11-11
BRISTOL MYERS SQUIBB CO
View PDF22 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0020] Many of these derivatives exhibit reduced hepatotoxicity, but they still have only limited water solubility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel compounds and methods for their production
  • Novel compounds and methods for their production
  • Novel compounds and methods for their production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0345] Example 1 - Sequencing of the Osbaycin PKS Gene Cluster

[0346] Genomic DNA was isolated from A. preliminaris (ATCC 31280) and A. miraculouse (DSM 43827, ATCC 29888) using standard protocols described by Kieser et al. (2000). DNA sequencing was performed using standard methods by the Sequencing Laboratory at the Biochemistry Department, University of Cambridge, Tennis Court Road, Cambridge CB2 1QW, Tennis Court Road, Cambridge CB2 1QW.

[0347] Using primers BIOSG104 5'-GGTCTAGAGGTCAGTGCCCCCGC GTACCGTCGT-3' (SEQ ID NO: 1) and BIOSG105 5'-GGCATATGC TTGTGCTC GGGCTCAAC-3' (SEQ ID NO: 2) amplified from Streptomyces hygroscopicus NRRL 3602 Gell The carbamoyltransferase encoding gene gdmN of the demycin biosynthetic gene cluster (sequence accession number: AY179507). Southern blot experiments were performed using DIG reagent and a non-radioactive nucleic acid labeling and detection kit (Roche) according to the manufacturer's instructions. A DIG-labeled gdmN DNA fragment wa...

Embodiment 2

[0355] Example 2 - Generation of gdmM inactivated strains

[0356] In-frame deletion of gdmM was performed as follows:

[0357] 2.1 Cloning of DNA homologous to gdmM upstream flanking regions

[0358] Using oligos gdm1for (SEQ ID NO: 12) and gdm1rev (SEQ ID NO: 13) to amplify Streptomyces hygroscopicus subsp. gordae using genomic DNA as a template in a standard PCR reaction using Pfu DNA polymerase (NRRL 3602) A region of 2268 bp in DNA. A 5' extension in each oligo introduces restriction sites to aid in cloning of the amplified fragments. The PCR product (PCRgdm1 ) covers the region of homology upstream of gdmM up to and including the first two amino acids of gdmM. This 2268bp fragment was cloned into pUC18 linearized with SmaI and dephosphorylated to obtain pUC18gdm1.

[0359] gdm1for TTAAGCTTGGACCGGCGCGAACTCGCGGACACCCACCT

[0360] Hind III

[0361] (SEQ ID NO: 12)

[0362] gdm1revTTTCTAGAGGTCATGCGCCCGCCAGGATCAGGTCGACC

[0363] wxya

[0364] (...

Embodiment 3

[0383] Example 3 - Strain Streptomyces hygroscopicus gdmM by knockout to gdmM -Supply of AHBA analogs to generate new geldanamycin analogs

[0384] 3.1 Using Streptomyces hygroscopicus gdmM - carry out biotransformation

[0385] Streptomyces hygroscopicus gdmM - As described in Example 2 above, the plaques thereof were transferred to MAM plates (medium 1) and cultured at 28°C for three days. Individual 50 mL falcon tubes were inoculated using 6 mm cylinders, each tube containing 10 mL of seed medium (per liter: glucose 40 g, beet molasses 10 g, yeast extract 2.5 g, peptone 2.5 g, tryptone 2.5 g, oat flakes 5 g) . These seed cultures were incubated at 28°C for 36-72 hours at 300 rpm with a 1 inch eccentricity. These were then used to inoculate (0.5 mL to 10 mL) production medium (same as seed medium) and cultivated at 28°C for 24 hours. 0.1 mL of 200 mM feed stock solution (dissolved in methanol - see Table 4 for list) was added to each falcon tube to give a final fee...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to ansamycin analogues that are useful, e.g. in the treatment of cancer, B-cell malignancies, malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases or a prophylactic pretreatment for cancer. The present invention also provides methods for the production of these compounds and their use in medicine.

Description

technical field [0001] The present invention relates to ansamycin analogues useful for the treatment of, for example, cancer, B-cell malignancies, malaria, fungal infections, central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases Or as a preventive pretreatment for cancer. The invention also provides methods for the production of these compounds and their use in medicine. Background of the invention [0002] The development of highly specific anticancer drugs with low toxicity and favorable pharmacokinetic profiles constitutes a major challenge in anticancer therapy. [0003] The 90kDa heat shock protein (Hsp90) is an abundant chaperone involved in protein folding and assembly, many of which are involved in signal transduction pathways (for review see Neckers, 2002; Sreedhar et al., 2004a; Wegele et al., 2004 et al. references). Nearly 50 of these so-called client proteins have been identified to date, including ster...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07D225/06A61K31/395A61P35/00
CPCY02A50/30
InventorC·马丁
OwnerBRISTOL MYERS SQUIBB CO