Phosphatidate phosphatase homolog and use of the same

A phosphatidic acid phosphatase, fatty acid technology, applied in application, hydrolase, food science and other directions, can solve problems such as no function

Inactive Publication Date: 2009-12-02
SUNTORY HLDG LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The existence of these homologs has also been confirmed in other fungi, but their function has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phosphatidate phosphatase homolog and use of the same
  • Phosphatidate phosphatase homolog and use of the same
  • Phosphatidate phosphatase homolog and use of the same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0249] PAP expression vector construction and transformant preparation

[0250] The present invention also provides a recombinant vector containing the nucleic acid encoding the PAP of the present invention. The present invention further provides a transformant transformed with the above-mentioned recombinant vector.

[0251] Such recombinant vectors and transformants can be obtained as follows. That is, the plasmid having the nucleic acid encoding the PAP of the present invention is digested with restriction endonucleases. The restriction endonucleases used are, for example, EcoRI, KpnI, BamHI, SalI, etc., but are not limited thereto. And the ends can also be blunted by T4 polymerase treatment. Purify the base sequence fragment after enzyme digestion by agarose gel electrophoresis. By integrating this nucleotide sequence fragment into an expression vector by a known method, a PAP expression vector can be obtained. The expression vector is introduced into the host to pr...

Embodiment 1

[0303] (1) EST analysis

[0304] Mortierella alpina (M.alpina) 1S-4 strain was inoculated into 100 ml of medium (1.8% glucose, 1% yeast extract, pH 6.0), and pre-cultivated at 28° C. for 3 days. Add 5L medium [1.8% glucose, 1% soybean powder, 0.1% olive oil, 0.01% Adecanol, 0.3% KH to 10L culture tank (Able Co., Tokyo) 2 PO 4 , 0.1%Na 2 SO 4 , 0.05% CaCl 2 2H 2 O, 0.05% MgCl 2 ·6H 2 0, pH 6.0], inoculate all the precultures, and culture with aeration and agitation under the conditions of 300rpm, 1vvm, and 26°C for 8 days. Glucose corresponding to 2%, 2%, and 1.5% was added on the 1st, 2nd, and 3rd day of culture, respectively. The bacterial cells were recovered at each stage of the 1st, 2nd, 3rd, 6th, and 8th days of culture, and the total RNA was prepared by the guanidine hydrochloride / cesium chloride method. Use Oligotex-dT30 mRNA Purification Kit (TaKaRa Bio), to purify poly(A) from total RNA + RNA. Using the ZAP-cDNA Synthesis Kit (STRATAGENE), the cDNA libr...

Embodiment 2

[0308] (1) Cloning of PAP homologous gene (MaPAP1)

[0309] In order to obtain a cDNA fragment containing the full-length ORF of the PAP homologous gene, primers were designed as follows:

[0310] Primer D-1: CATGGGTTGCTTCGCGCGCAAGACG (SEQ ID NO: 5)

[0311] Primer D-2: CGAAGCCGGCAAAGGCGGCAGTC (SEQ ID NO: 6)

[0312] A PCR reaction was carried out using ExTaq (TaKaRa Bio) using the cDNA library on day 8 as a template and using the above-mentioned primers. The obtained 0.64 kbp DNA fragment was subjected to TA cloning using TOPO-TA cloning Kit (INVITROGEN), and the base sequence of the insert was determined.

[0313] As a result, it was confirmed that a DNA fragment including the 113th to 744th base sequence of SEQ ID NO: 1 was cloned, and this plasmid was designated as pCR-2051-P. Then, PCR reactions were carried out using the plasmid pCR-2051-P as a template and using the same primers as above. ExTaq (TaKaRa Bio) was used in the reaction, but the PCR labeli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

It is intended to provide a novel phosphatidase phosphatase gene. A nucleic acid which contains the base sequence represented by SEQ ID NO:1 or 4 or its fragment.

Description

technical field [0001] This specification claims priority based on Japanese Patent Application No. 2007-181899 filed on July 11, 2007. [0002] The present invention relates to novel phosphatidic acid phosphatase genes. Background technique [0003] Fatty acids are important components of lipids such as phospholipids and triacylglycerols. Fatty acids containing more than two unsaturated bonds are collectively called polyunsaturated fatty acids (PUFA), known as arachidonic acid, dihomo-γ-linolenic acid, eicosapentaenoic acid, docosahexaenoic acid, etc. . The polyunsaturated fatty acids include polyunsaturated fatty acids that cannot be synthesized in animals, and these polyunsaturated fatty acids need to be ingested from food as essential fatty acids. Polyunsaturated fatty acids are widely distributed, for example, arachidonic acid can be isolated from lipids extracted from animal adrenal glands and livers. However, the amount of polyunsaturated fatty acid contained in an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C12N1/15C12N1/19C12N1/21C12N5/10A23L1/03C12P7/64C12N9/16A23L29/00C12P7/6427
CPCC12P7/6409C12P7/6427A23L1/3008C12N9/16A23L33/12
Inventor落合美佐得田久敬
OwnerSUNTORY HLDG LTD