Plant expression vector for improving capability of assimilating and formaldehyde absorption of plant and application thereof

A plant expression vector and the technology of the vector, which is applied in the field of plant genetic engineering, can solve the problems of assimilation and absorption of formaldehyde, which are not seen, and achieve the effect of improving the ability of plants to absorb and tolerate exogenous formaldehyde and enhancing the efficiency.

Inactive Publication Date: 2010-01-20
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there is no report on the plant expression vector pK2-35S-PrbcS-*T-hps / phi that improves the ability of plants to assimilate and absorb formaldehyde in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector for improving capability of assimilating and formaldehyde absorption of plant and application thereof
  • Plant expression vector for improving capability of assimilating and formaldehyde absorption of plant and application thereof
  • Plant expression vector for improving capability of assimilating and formaldehyde absorption of plant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1: Construction of hps / phi gene plant expression vector pK2-35S-PrbcS-*T-hps / phi

[0071] (1) Amplification and TA cloning of hps / phi gene:

[0072] The amplification of hps / phi gene and the strategy of TA cloning are as follows: figure 2 As shown, using the pET-23a-hps / phi plasmid as a template, design specific primers for the hps / phi gene (upstream primer 5'rmpA: CACC GCATGC AGCTCCAAGTCGCCATCG (SphI), downstream primer 3'rmpB: TCTAGA TCACTCGAGGTTGGCGTGGCGCG(XbaI)) for amplification. Use the upstream and downstream specific primers 5'rmpA and 3'rmpB of the hps / phi gene for PCR, add 50ng of pET-23a-hps / phi plasmid as a template in the PCR reaction mixture, and add 75ng of the specific primer 5'rmpA at the same time And 3'rmpB, 4μldNTP (2.5mM), 25μl of 2×GC BufferI and 0.25μl of LA taq (5U / μl) polymerase (Takara), add double distilled water to make the final reaction volume 50μl. Heat at 94°C for 2 minutes on the PCR instrument, then follow the program ...

Embodiment 2

[0077] Embodiment 2: transform Agrobacterium with the plant expression vector that contains hps / phi gene

[0078] Prepare the competent cells of Agrobacterium, transfer the above-mentioned constructed plant expression vector pK2-35S-PrbcS-*T-hps / phi into Agrobacterium (C58Cl(pPMP90)) by electric pulse method, add spectinomycin Transformants were screened on the plate. Take a small amount of plasmid and add it to the competent cells of Agrobacterium, mix gently; add the mixture into the pre-cooled electroporation cup, tap the cup body gently to make the mixture fall to the bottom of the cup; place the electroporation cup on the electroporation In the chute of the instrument (BIO-RAD), use a 1mm electric shock cup and 200 ohm, 2.5kV / 0.2cm parameters for electric shock, immediately take out the electric conversion cup after electric shock, quickly add 0.5ml SOC medium, mix well, transfer to 1.5 ml centrifuge tube; 28°C, 200rpm shaker culture 3-5h; room temperature, 7500rpm centr...

Embodiment 3

[0079] Embodiment 3: transform plant with the Agrobacterium that contains hps / phi gene plant expression vector

[0080] Pick a single colony of Agrobacterium carrying the plasmid pK2-35S-PrbcS-*T-hps / phi and inoculate it in 50ml of LB medium (containing Spe, 100μg / ml), culture at 180rpm at 28°C for 24h, and wait until the OD 600 To about 1.0, centrifuge for 10min (3000rpm) to precipitate the bacteria. Then use about 10ml of MS liquid medium to suspend, centrifuge for 10min (3000rpm), and precipitate the bacteria. Repeat the above operation 2 to 3 times. Finally, a certain volume of MS liquid medium was added to resuspend, so that the OD of the bacteria 600 The value is 0.5. Geranium sp. frensham (Pelargonium sp. frensham) aseptic seedlings are prepared, geraniums are transformed by leaf disc method through Agrobacterium mediated, and then seedlings are obtained by tissue culture, and further screened to obtain desired transgenic plants. The specific steps are as follows: c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant expression vector pK2-35S-PrbcS-*T-hps / phi for improving the metabolic capability of assimilating and formaldehyde absorption of plants, and the plant expression vector is a plant expression vector of a bifunctional enzyme HPS / PHI gene formed by integrating a PrbcS containing a Rubisco 3C small subunit gene and a transfer peptide sequence thereof as well as 6-phosphonate hexulose synthetase and 6-osphofructose isomerase of Mycobacteriumgastri MB19. A procaryon expression vector pET-23a-hps / phi plasmid of HPS / PHI is used as a template and is amplified to acquire an hps / phi gene, and the PrbcS and a chloroplast transfer peptide are used for controlling the expression of the hps / phi gene in the chloroplast of plant leaves, thereby improving the capability of assimilating and formaldehyde absorption of the plants. An experiment indicates that the growing condition of transgenic plants is better than that of wild plants, and the transgenic plants have a lighter phenomenon of leaf chlorosis when the transgenic plants grow in the environments of high-concentration extrinsic gas and liquid formaldehyde. Transgenic plant leaves can completely eliminate the formaldehyde in 4mM of formaldehyde treatment fluid within 90 hours, but wild leaves have slower absorption efficiency, and 17 percent of formaldehyde still remains.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a plant expression vector pK2-35S-PrbcS-*T-hps / phi required for improving the ability of plants to assimilate and absorb formaldehyde and its role in improving plant absorption and tolerance to exogenous formaldehyde application of capabilities. Background technique [0002] Formaldehyde has been recognized as a major indoor air pollutant at present, and its pollution sources come from smog, furniture, industrial adhesives and varnishes (shah and singh 1988). Formaldehyde is extremely reactive and can react non-specifically with proteins, nucleic acids and lipids. It is a very active compound (Feldman et al., Prog Nucleic Acid Res Mol Biol, 1973, 13: 1-49), so it is highly effective for all All organisms are highly toxic. At present, there are three methods commonly used to remove polluted formaldehyde: one is to use environmentally friendly materials; the o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82
Inventor陈丽梅宋中邦殷飞李昆志马莉胡清泉陈红梅
OwnerKUNMING UNIV OF SCI & TECH