Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament

A preparation and drug technology, applied in the preparation method of peptides, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of toxic and side effects, unreasonable, impossible, etc., and achieve good therapeutic effect and obvious anti-myocardial Reconstructed, curative effect

Active Publication Date: 2010-02-17
ARMY MEDICAL UNIV +2
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, as far as the current available technology is concerned, it is impossible and unreasonable to use transgenic technology for the treatment of adult-onset human myocardial remodeling / hypertrophy
In addition, since Gqα also has important physiological functions, knocking out the expression of Gqα in the heart will cause serious toxic side effects, so the above two strategies and methods have no practical application value in the prevention and treatment of clinical myocardial remodeling / hypertrophy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament
  • Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament
  • Anti-myocardial remodelling polypeptide, preparation method thereof, preparations and application thereof in preparation of anti-myocardial remodelling medicament

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1: the solid-phase synthesis of polypeptide

[0063] 1. Synthesis and purification process of 27 peptide

[0064] In the following steps, 25 g of resin (with a substitution constant of 0.6 mmol / g) was charged according to the pilot scale. The production scale is 1kg resin, and the feeding amount is increased proportionally to prolong the reaction time.

[0065] (1) Synthesis process of 27 peptide

[0066] 1. Accurately weigh 25g of Fmoc-Val-Wang resin, place it in a 1000ml reactor, add 500ml of DCM, shake and soak for 30min, wash twice with 500ml each of DCM, MeOH, and DMF, and remove the solvent by suction filtration.

[0067] 2. Add 500ml 20% Piperidin / DMF, shake at room temperature, react for 30min, and remove the N-terminal Fmoc protecting group. After the solvent was removed by suction filtration, the resin was washed twice with 500 ml each of DMF, MeOH and DCM, and the solvent was removed by suction filtration.

[0068] 3. Dissolve 21.2g Fmoc-Leu-OH...

Embodiment 2

[0120] Example 2: Genetic engineering expression and purification of 55 peptide and 27 peptide

[0121] According to the gene sequences of 55 peptides and 27 peptides, the corresponding oligonucleotide sequences were designed for the construction of their expression vectors.

[0122] Synthesize four oligonucleotide single strands for 55 peptides:

[0123] 55-1: 60bp

[0124] 5'tcgagctccatgggtcgagaattcattctgaagatgttcgtcgactaaacgttctctgca 3'

[0125] 55-2: 52bp

[0126] 5'gagaacgtttagtcgacgaacatcttcagaatgaattctcgacccatggagc 3'

[0127] 55-3: 85bp

[0128] 5'gaggtcgacctgaacccagacagtgacaaaattatctactcccacttcacgtgtgccacagacaccg

[0129] agaatatccgctttgtct 3'

[0130] 55-4: 85bp

[0131] 5'tagcccggggaccagattgtactccttcaggttcagctggaggatggtgtccttgacggctgcaaag

[0132] acaaagcggatattctcg 3'

[0133] Synthesize oligonucleotide single strands for 27 peptides:

[0134] 27-1:

[0135] 5'catggacacccgagaatatccgctttgtctttgcagccgtcaaggacaccacctccagctgaacctga

[0136] aggagtacaatctggt...

Embodiment 3

[0142] Example 3: The series of polypeptides of the present invention can significantly reduce the protein content in the rat cardiomyocyte hypertrophy model induced by norepinephrine

[0143] 1. Wistar rats (purchased from the Experimental Animal Center of Third Military Medical University) 1-3 days after birth were taken out, killed by cervical dislocation, and fixed on the dissection table. Disinfect the ventral skin with 2% tincture of iodine and 75% ethanol. Take out the heart and cut it into about 1~3mm 3 Digest the fragments of the same size with digestion solution containing 0.08% trypsin, 0.02% EDTA, 0.05% collagenase II repeatedly, collect the cells in DMEM containing 10% fetal bovine serum, 37°C, 5% CO 2 cultured in an incubator.

[0144] 2. After culturing the cardiomyocytes for 48 hours, replace them with serum-free DMEM medium, continue to cultivate for 24 hours, and add drugs according to the following experimental groups:

[0145] Normal control group: add 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a G protein competitive inhibitory peptide, which starts from a 55 peptide sequence and obtains a series of derived polypeptides by deleting amino acid residues in any number more than one in any point from the first amino acid residue at the amino end and at least remaining twelve amino acid residues at the amino end. The length of the polypeptide is shortened up to 78.2 percent; and the polypeptide has a remarkable effect on anti-myocardial remodelling. The invention also relates to a method for preparing the series of derived polypeptides, which successfully synthesizes a target polypeptide with the purity up to 99.2 percent by utilizing advanced peptide synthesis technology. The invention further relates to the preparations containing the polypeptides and the application thereof in the preparation of an anti-myocardial remodelling medicament.

Description

technical field [0001] The present invention relates to a polypeptide, more specifically, the present invention relates to a competitive inhibitory peptide of Gq protein α; the present invention also relates to the preparation method of the polypeptide, the preparation containing the polypeptide and the preparation of the polypeptide against myocardial remodeling application in medicine. Background technique [0002] Myocardial remodeling (i.e., the usual cardiac hypertrophy) refers to the increase in the volume of cardiomyocytes while the number remains unchanged. It is the common response of cardiomyocytes to various pathological stimuli. Changes in blood rheology such as disease and increased exercise-induced pressure load, and stimulation by humoral endocrine substances such as endothelin, angiotensin II, catecholamines, transforming growth factor β, and interleukin-1 can all lead to myocardial hypertrophy, so the incidence rate is extremely high [1] . Only in terms of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47C12N15/12C12N15/63C12N15/70C07K1/04A61K38/17A61P9/00
Inventor李晓辉周见至张海港李淑慧
OwnerARMY MEDICAL UNIV