Preparation method of acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as application thereof
A technology of Thiobacillus ferrooxidans and genetically engineered strains, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of activity decline, death, slow growth rate, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0210] Example 1. Construction of the shuttle plasmid pJRD215-PT with expression ability
[0211] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the pQE30 plasmid sequence provided by Qiagen. T5 promoter upstream primer: GGC GTC GAC CTCGAGAAATCATAAAAAAT (underlined endonuclease SalI site), downstream primer: TA TCTAGA ACCCGGGGTACCGAGCTC (underlined endonuclease XbaI site). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.
[0212] (2) Extraction of pJRD215 and pQE30 plasmids: Streak culture on the plate overnight, pick a single clone and inoculate it in a liquid medium for culture, collect 6 mL of bacteria and extract the plasmids according to the instructions of EasyPure Plasmid MiniPrep Kit of Quanshijin Company. The mentioned plasmid solutions were stored at -20°C until use.
[0213] (3) Amplification of T5 promoter and T0 terminator: the reaction system is H 2 ...
Embodiment 2
[0218] Embodiment 2. PCR amplification of Micrococcus luteus rpf gene
[0219] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the rpf gene sequence of Micrococcus luteus published in GenBank. Upstream primer (B-F): ATC GGTACC ATGGACACCATGACTCTC (underlined endonuclease KpnI site), downstream primer (B-R): tgaaccacctgaaccacctgaaccacctgaaccacc GGCCTGCGGCAGGACGAG (GGS chain underlined). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.
[0220] (2) Extraction of Micrococcus luteus genomic DNA: Micrococcus luteus was streaked on a brain-heart solid plate and cultured in 2ml of liquid medium. Genomic DNA was extracted according to the kit instructions. First, add 200 μl buffer GA to the cell pellet, shake until the cells are completely suspended, add 20 μl proteinase K solution to the tube, mix well, add 20 μl proteinase K solution to the tube, mix well, briefly centrif...
Embodiment 3
[0225] Example 3. PCR amplification of the C. crescentus cc3302 gene
[0226] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the cc3302 gene sequence of Caulobacter crescentus published in GenBank. Upstream primers (C-F): ggtggttcaggtggttcaggtggttcaggtggttca ATGTGGCGGTCGCCTGTG (GGS chain is underlined), downstream primer (C-R): agatcctccagatcctccagatcctccagatcctcc ATTACGCGTCATGACTGAG (GGS chain is underlined). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.
[0227] (2) Extraction of Genomic DNA of Caulobacter crescentus: Streak culture of Caulobacter crescentus on a solid plate, pick a single clone to culture in 2ml liquid medium, and use Tiangen Company bacterial genomic DNA extraction reagent after centrifugation to collect the bacteria Box instructions for extraction of genomic DNA. First, add 200 μl buffer GA to the cell pellet, shake until the cells are com...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 