Method for breeding transgenic livestock rich in polyunsaturated fatty acid

A technology of transgenic cells and fatty acid dehydrogenase, applied in the fields of botanical equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve the problems of fish oil discomfort and increase the cost of feeding

Inactive Publication Date: 2010-11-17
BEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, fish oil is not suitable for all people due to its high heat and special smell, and the absorption will vary according to individual physiological conditions
Adding polyunsaturated fatty acid ingredients to animal feed has been widely used to increase the polyunsaturated fatty acid content of meat products (Wood and Enser, 1997), but this method will greatly increase the cost of feeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for breeding transgenic livestock rich in polyunsaturated fatty acid
  • Method for breeding transgenic livestock rich in polyunsaturated fatty acid
  • Method for breeding transgenic livestock rich in polyunsaturated fatty acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, rich in polyunsaturated fatty acid transgene

[0027] 1) Construction of FAT-2 gene expression vector

[0028] According to the cDNA sequence (NM_070159) of Caenorhabditis elegans (C.elegans) FAT-2 on GenBank, according to mammalian codons (including mouse, pig, cattle, sheep, a total of 70882 coding sequences, 31346087 codon information, http : / / www.kazusa.or.jp / codon / ) to optimize the codons in the coding region of the FAT-2 gene, and design a FAT-2 gene sequence suitable for expression in mammalian cells or in vivo, see sequence 1. Design three DNA fragments according to sequence 1 (F1, F2 and F3, there is a 20bp sequence overlap between F1 and F2, and between F2 and F3) or direct whole gene artificial synthesis, and design a pair of HindIII in the upstream and downstream respectively and XbaI restriction site primers (upstream primer: 5'CCAGAAGCTTAAGATGACAATCGCTACAA 3', downstream primer: 5'CCA CTC TAG ATC ATT GAG CCT TCT TAG CCT 3'), the complete new...

Embodiment 2

[0048] Embodiment 2, rich in polyunsaturated fatty acid transgenic livestock

[0049] 1) Preparation of transgenic livestock rich in polyunsaturated fatty acids

[0050] Methods for preparing transgenic livestock include microinjection, somatic cell cloning, and sperm carrier methods. Transgenic livestock include transgenic pigs, transgenic sheep, and transgenic cattle. The present invention prefers somatic cell cloning method to prepare transgenic pigs, but is not limited to somatic cell cloning method, and is not limited to the preparation of transgenic pigs.

[0051] Take pig ear tissue to inoculate and culture fibroblasts (see "Guidelines for Cell Experiments"), digest pBudCE-FAT1, pBudCE-FAT2 and pCI-neo with NheI, and transfect pig fibroblasts at a molar ratio of 3:3:1 (The transfection method is the same as in Embodiment 1), and through G418 screening and PCR identification (the identification method is the same as in Example 1), it is determined to be transgene positi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for breeding transgenic livestock rich in polyunsaturated fatty acid. The method comprises the following steps of: guiding DNA molecules which have a sequence 1 and a sequence 2 in a sequence list into somatic cells of a mammal to obtain transgenic cells in which a delta-12 fatty acid dehydrogenase and an omega-3 fatty acid dehydrogenase are expressed; cloning embryos by using the transgenic cells as nuclear transfer donor cells and using isolated ovocytes as nuclear transfer acceptor cells by nuclear transfer technology; and transplanting the cloned embryos into a uterus of the livestock by a non-operation method for gestation to obtain the transgenic livestock. The method of the invention can ensure that the delta-12 fatty acid dehydrogenase and the omega-3 fatty acid dehydrogenase are stably expressed in the body of a transgenic pig and that the content of omega-3 polyunsaturated fatty acids (PUFAs) in meat of the livestock is improved obviously.

Description

technical field [0001] The present invention relates to a method for producing transgenic livestock rich in polyunsaturated fatty acids. Background technique [0002] Polyunsaturated fatty acids (PUFAs) are very important to human nutrition and health, and play an important role in promoting the development of the retina and brain, preventing and treating cardiovascular and cerebrovascular diseases, and inhibiting the proliferation of tumor cells. [0003] Polyunsaturated fatty acids are mainly divided into two categories: one is ω-3PUFAs, ω-3PUFAs are polyunsaturated fatty acids whose first double bond appears on the third carbon atom from the methyl end of the fatty acid carbon chain. Fatty acids, which belong to the class of linolenic acids, mainly include α-linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). The other type is ω-6PUFAs. ω-6PUFAs are polyunsaturated fatty acids whose first double bond appears on the 6th carbon atom from the m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/06A01K67/027C12N15/53
Inventor汤波孔平李宁
OwnerBEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY