Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lactase mutator, secretory expression method and application thereof

A technology of mutant gene and lactase is applied to improve the secretion and expression level of lactase gene in Pichia pastoris. In the field of lactase mutant gene, it can solve the problems of need for improvement, pH acidity, poor thermal stability of the enzyme, etc.

Inactive Publication Date: 2012-01-11
北京森根比亚生物工程技术有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But both have the following defects in practical application: the lactase derived from yeast is a neutral lactase, which has poor thermal stability and a narrow pH range; the lactase derived from Aspergillus has good thermal stability and a wide pH range of action. But the most suitable pH is acidic
The present inventors have found through experiments that the lactase encoded by the gene has good enzymatic properties such as high specific activity and high thermostability, but the secreted expression level of the lactase gene in the host is low and needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactase mutator, secretory expression method and application thereof
  • Lactase mutator, secretory expression method and application thereof
  • Lactase mutator, secretory expression method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1 Cloning of lactase gene (SEQ ID NO.1), expression in Pichia pastoris and determination of enzymatic properties

[0043] 1 Cloning of lactase gene (SEQ ID NO.1) and its expression in Pichia pastoris

[0044] 1.1 Strains and plasmids

[0045] Animal Bifidobacterium animalis (Bifidobacterium animalis) B106 was screened by the inventor's laboratory;

[0046] The pEASY-T1 cloning vector and Top10 Escherichia coli competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0047] The expression vector pPIC9 and Pichia pastoris recipient strain GS115 are products of Invitrogen.

[0048] 1.2 Preparation of medium and related solutions

[0049] LB medium: 0.5% yeast extract, 1.0% peptone, 1.0% NaCl, (solid medium containing 1.5% agar) 121 ° C damp heat sterilization for 15 minutes;

[0050] MRS medium: tryptone 10g, Tween 8.01g, beef extract 10g, glucose 20g, yeast extract 5g, triammonium citrate 2g, sodium acetate 10g, magnesium sulfate 0....

Embodiment 2

[0215] Example 2 The complete gene modification of lactase gene bg42-106 and its expression in Pichia pastoris

[0216] 1. Strains and plasmids

[0217] Top10 Escherichia coli competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0218] The expression vector pPIC9 and Pichia pastoris recipient strain GS115 are products of Invitrogen.

[0219] 2. Whole gene modification of lactase gene bg42-106

[0220] In order to increase the expression level of the lactase gene bg42-106 derived from Bifidobacterium animalis B106 strain in Pichia pastoris, the cloned SEQ ID NO.1 was according to the codon preference of Pichia pastoris without changing its amino acid Optimize the codon and GC content of the gene.

[0221] Depend on Figure 11 and Figure 12 It can be seen that the optimized lactase gene (SEQ ID NO.2) has changed 461 bases in total, and the GC% content has changed from 61.11% to 53.79%. The modified lactase gene fragment (SEQ ID NO.2, synthesiz...

Embodiment 3

[0225] Example 3 Co-expression of protein disulfide bond isomerase improves the secretion of lactase in recombinant yeast

[0226] 1. Strains and plasmids

[0227] Yeast recipient strain 106-GS115 8# (the yeast strain containing the unmodified lactase bg42-106 progene (SEQID NO.1) and the highest extracellular enzyme activity), plasmid vector pPICZA and Pichia pastoris strain GS115 is a product of Invitrogen, and Escherichia coli Top10 strains were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0228] 2. Cloning of disulfide bond isomerase gene PpPDI and construction of recombinant expression vector

[0229] According to the PDI gene sequence of Pichia pastoris published in GenBank Accession No.AJ302014.1, the primer PpPDI-F (5'GC GAATTC ATGCAATTCAACTGGGATATTAAAACTG (EcoR I) 3') and PpPDI-R (5'AT GCGGCCGCTAAAGCCGCGGCGTCT(Not I) 3'), using high-fidelity Taq enzyme to perform PCR amplification to obtain a PpPDI gene fragment with a size of about 1.6kb, which wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lactase mutator with optimized codon and high specific activity and a secretory expression method thereof. The lactase gene cloned in bifidobacterium animalis is optimized for codon of the gene and the GC content on condition that the amino acid sequence of the gene is not changed according to the preference of the codon of Pichia pastoris; the optimized lactase gene is shown as SEQ ID NO.2. After optimizing, 461 basic groups are changed; the percentage of GC% is lowered to 53.79% from 61.11%t; the enzymatic activity of the lactase is obviously increased after the codon is optimized. Moreover, the method shows that: since the lactase gene and protein disulfide isomerase are transformed into the Pichia pastoris cell, the relative activity of the lactase is obviously increased; and the secretory expression content of the lactase gene in the Pichia pastoris is obviously increased.

Description

technical field [0001] The present invention relates to a lactase mutant gene, in particular to a lactase mutant gene obtained by codon-optimizing a lactase gene derived from Bifidobacterium animalis. The method for secreting expression levels in yeast belongs to the field of lactase preparation. Background technique [0002] Lactase (β-D-galactoside galactohydrolase, β-D-galactoside galactohydrolase, EC3.2.1.23) has dual functions of hydrolysis and transglycoside. On the one hand, people use its hydrolysis function to produce low-lactose dairy products to relieve various adverse reactions caused by lactose intolerance patients' consumption of dairy products; Galactose (Hydrolysis of lactose: a literature review. Journal Name: Process Biochem.; (United Kingdom); Journal Volu-me: 20: 1 1985, Medium: X; Size: Pages: 2-12.). Lactase widely exists in plants, microorganisms and animal intestinal cells. At present, commercially produced lactase is mainly derived from microbial ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/56C12N15/81C12N1/19C12N9/38C12R1/84
Inventor 张伟张宇宏范云六
Owner 北京森根比亚生物工程技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com