Lactase mutator, secretory expression method and application thereof
A technology of mutant gene and lactase is applied to improve the secretion and expression level of lactase gene in Pichia pastoris. In the field of lactase mutant gene, it can solve the problems of need for improvement, pH acidity, poor thermal stability of the enzyme, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1 Cloning of lactase gene (SEQ ID NO.1), expression in Pichia pastoris and determination of enzymatic properties
[0043] 1 Cloning of lactase gene (SEQ ID NO.1) and its expression in Pichia pastoris
[0044] 1.1 Strains and plasmids
[0045] Animal Bifidobacterium animalis (Bifidobacterium animalis) B106 was screened by the inventor's laboratory;
[0046] The pEASY-T1 cloning vector and Top10 Escherichia coli competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;
[0047] The expression vector pPIC9 and Pichia pastoris recipient strain GS115 are products of Invitrogen.
[0048] 1.2 Preparation of medium and related solutions
[0049] LB medium: 0.5% yeast extract, 1.0% peptone, 1.0% NaCl, (solid medium containing 1.5% agar) 121 ° C damp heat sterilization for 15 minutes;
[0050] MRS medium: tryptone 10g, Tween 8.01g, beef extract 10g, glucose 20g, yeast extract 5g, triammonium citrate 2g, sodium acetate 10g, magnesium sulfate 0....
Embodiment 2
[0215] Example 2 The complete gene modification of lactase gene bg42-106 and its expression in Pichia pastoris
[0216] 1. Strains and plasmids
[0217] Top10 Escherichia coli competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;
[0218] The expression vector pPIC9 and Pichia pastoris recipient strain GS115 are products of Invitrogen.
[0219] 2. Whole gene modification of lactase gene bg42-106
[0220] In order to increase the expression level of the lactase gene bg42-106 derived from Bifidobacterium animalis B106 strain in Pichia pastoris, the cloned SEQ ID NO.1 was according to the codon preference of Pichia pastoris without changing its amino acid Optimize the codon and GC content of the gene.
[0221] Depend on Figure 11 and Figure 12 It can be seen that the optimized lactase gene (SEQ ID NO.2) has changed 461 bases in total, and the GC% content has changed from 61.11% to 53.79%. The modified lactase gene fragment (SEQ ID NO.2, synthesiz...
Embodiment 3
[0225] Example 3 Co-expression of protein disulfide bond isomerase improves the secretion of lactase in recombinant yeast
[0226] 1. Strains and plasmids
[0227] Yeast recipient strain 106-GS115 8# (the yeast strain containing the unmodified lactase bg42-106 progene (SEQID NO.1) and the highest extracellular enzyme activity), plasmid vector pPICZA and Pichia pastoris strain GS115 is a product of Invitrogen, and Escherichia coli Top10 strains were purchased from Beijing Quanshijin Biotechnology Co., Ltd.
[0228] 2. Cloning of disulfide bond isomerase gene PpPDI and construction of recombinant expression vector
[0229] According to the PDI gene sequence of Pichia pastoris published in GenBank Accession No.AJ302014.1, the primer PpPDI-F (5'GC GAATTC ATGCAATTCAACTGGGATATTAAAACTG (EcoR I) 3') and PpPDI-R (5'AT GCGGCCGCTAAAGCCGCGGCGTCT(Not I) 3'), using high-fidelity Taq enzyme to perform PCR amplification to obtain a PpPDI gene fragment with a size of about 1.6kb, which wa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 