Method for constructing high-yield polyglutamic acid engineering strain

A technology of polyglutamic acid and engineering strains, applied in the biological field, can solve problems such as limited oxygen utilization, complex synthetic metabolic pathways, and high viscosity of fermentation broth

Inactive Publication Date: 2011-02-09
INST OF BIOPHARM OF SHANDONG PROVINCE
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complex metabolic pathway of PGA in microorganisms, which involves energy metabolism, the concentration of PGA in the fermentation broth is relatively low, and the viscosity of the fermentation broth is high, which limits the utilization of oxygen, resulting in a low yield of PGA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing high-yield polyglutamic acid engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1: Construction of Bacillus subtilis integration vector expressing hemoglobin gene

[0014] Using conventional molecular biology techniques, the nucleotide sequences at positions 1-500 and 1381-1984 at the 5' end of the Bacillus subtilis amylase gene were cloned into the Xho I, HindIII, Xba I, and SacII positions of the pBluescriptsk (-) plasmid, respectively. Between the points, the primers used are: AmyE15'ATTGCTCGAGATGT TTGCAAAACGATTCAAA3'; AmyE25'GGATAAGCTTTGTGTGTTTCC ATGT GTCCAGT3'; AmyE35'ATTGTCTAGAGCTGTGCTTTATCCTGATGATA3'; AmyE45'ATTACCGCGGTCAATGGGGAAGAGAACCGCT3';

[0015] Using the Bacillus subtilis genome as a template, using P15'ATTAGAATTCTGTCGACGT GCATGCAGGC3'; P25'TAGGATCCTATAATGGTACCGCTATCACT3' as primers to amplify the P43 promoter gene by PCR; insert it between the EcoR I and BamH I sites of the pBluescriptsk (-) plasmid;

[0016] Using pUC19-vgb as a template and using VGB15'ATTGGATCCGGAAGACCCTCATGT TAGA3'; VGB25'ATTATCTAGATTATTCAACCGCTTGAGCGTA3'...

Embodiment 2

[0018] Example 2: Construction of high-yield γ-polyglutamic acid engineered bacteria

[0019] The vector pSK(-)-P43-vgb constructed in Example 1 was linearized with restriction endonuclease Xho I or SacII; dephosphorylated with alkaline phosphatase, recovered and used for electrotransformation. The specific method is as follows:

[0020] (1) Inoculate B. subtilis in 3ml LB medium and culture overnight. (2) Take 2.6 mL of the overnight culture and inoculate into 40 mL (LB+0.5 mol / L sorbitol), and culture at 37°C and 200 r / min until OD600=0.85-0.95. (3) Bath the bacterial solution in ice water for 10 minutes, then centrifuge at 4°C for 5 minutes under a centrifugal force of 5000 g, and collect the bacterial cells. (4) Use 50mL pre-cooled electroporation medium (0.5mol / L sorbitol, 0.5mol / L mannitol, 10% glucose), re-suspend the bacteria, centrifuge at 5000g, 5min, 4°C to remove the supernatant, and rinse like this 4 times. (5) Suspend the washed cells in 1 mL electroporation ...

Embodiment 3

[0021] Example 3: Verification of high-yield γ-polyglutamic acid in genetically recombined Bacillus subtilis

[0022] Inoculate the original strain and the genetically recombined strain obtained in Example 2 into 250 mL Erlenmeyer flasks containing 50 mL of seed medium, and culture overnight at 37° C., with a shaker speed of 210 r / min. The cultured seeds were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium at an inoculation amount of 2%, and cultured at 37° C. for 48 to 72 hours, with the shaker rotating at 210 r / min. After the fermentation, take 1mL of fermentation broth, dilute it 10 times, centrifuge at 12000r / min, 4°C for 10min, take the supernatant, filter it through a microporous membrane, and perform chromatographic analysis. The chromatographic analysis conditions are: chromatographic column: Hypersil BDS C18, 5μm , 4.6mm×250mm; mobile phase: disodium hydrogen phosphate-potassium dihydrogen phosphate, pH6.98; flow rate: 1mL / min; column ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing a high-yield gamma-polyglutamic acid engineering strain by using gene engineering technology, and aims to greatly improve the yield of the gamma-polyglutamic acid at a lower dissolved oxygen level. In the method of the invention, a hemoglobin gene (vgb) of vitreoscilla hemoglobin is imported into a gamma-polyglutamic acid producing strain cell by using the gene engineering technology, so that the vitreoscilla hemoglobin (VHb) is successfully expressed; and thus, the utilization ratio of oxygen by a recombinant strain and the yield of producing the gamma-polyglutamic acid by a fermentation method are improved. Results show that the capacity of producing the gamma-polyglutamic acid by the recombinant strain is improved by 1.8 times during the fermentation, so that the problem of high dissolved oxygen requirement during the large-scale production of the gamma-polyglutamic acid is solved, and the feasibility is provided for the large-scale industrial production of the gamma-polyglutamic acid.

Description

technical field [0001] The invention relates to a recombinant gamma-polyglutamic acid production bacterium in the field of applied microorganisms and fermentation engineering, its construction method and the application of the gamma-polyglutamic acid fermented by the bacterium, belonging to the field of biotechnology. Background technique [0002] γ-polyglutamic acid (poly-γ-glutamic acid, poly-γ-glutamic acid, referred to as PGA) is a water-soluble polyamino acid produced by microbial fermentation in nature. γ-carboxyl group forms a high molecular weight polymer of peptide bonds. The molecular weight distribution is between 100kDa and 10000kDa. Poly-γ-glutamic acid has excellent water solubility, super adsorption and biodegradability, and the degradation product is pollution-free glutamic acid. It is an excellent environment-friendly polymer material and can be used as a water-retaining agent, Heavy metal ion adsorbents, flocculants, slow-release agents, and drug carriers...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/02C12N15/75C12R1/125
Inventor苏移山朱希强张晓员侯重文郭学平凌沛学
OwnerINST OF BIOPHARM OF SHANDONG PROVINCE