Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group and kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and detection method thereof

A technology of Pasteurella rabbits and Bordetella rabbits, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of not finding Pasteurella rabbits, etc., and achieve the effect of long course of disease

Active Publication Date: 2011-02-23
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] After searching the literature of the prior art, no relevant research reports on multiple PCR detection kits for Pasteurella rabbits and Bordetella rabbits and their detection methods were found. Therefore, it is necessary to develop multiple PCR detection kits for Pasteurella rabbits and Bordetella rabbits.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and detection method thereof
  • Primer group and kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and detection method thereof
  • Primer group and kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The kits and detection methods involved in this embodiment are as follows.

[0034] 1. Kit

[0035] The multiplex PCR detection kit of this embodiment includes 7 cryopreservation tubes, 50 PCR reaction tubes and instructions. The 7 cryopreservation tubes are respectively: code-named cryopreservation tube A (2) containing 2×PCR core reagent premix (Taq enzyme, dNTPs mixture and MgCl 2 solution, commercially available), cryopreservation tubes B and C are respectively equipped with 50ul positive DNA solutions of Pasteurella rabbit and Bordetella, cryopreservation tube D is equipped with 0.5ml DL2000 molecular weight standard solution (commercially available), and cryopreservation tube E is equipped with 1.5mlddH 2 O, cryopreservation tube F is equipped with the primer mixture used in the PCR system, Pasteurella rabbit primers: 5'GAGTCTAGAGTACTTTAGGGA 3', 5'ACTTTCTGAGATTCGCTC 3'; Bordetella rabbit primers: 5'TGAACAATGGCGTGAAAG 3', 5'TCGATAGTAGGACGGGAGG 3'; All cryovials ...

Embodiment 2

[0047] The materials involved in this case are as follows: reference strains of Pasteurella, Bordetella, Salmonella, Escherichia coli, and Clostridium welchii from rabbits were all purchased from China Veterinary Drug Control Institute.

[0048] Inoculate the above bacteria into 2ml enrichment broth medium, cultivate overnight at 37°C, and then conduct the following tests:

[0049] 1. Sensitivity test

[0050] The Pasteurella and Bordetella bacterial liquids that were shaken overnight at 37°C were serially diluted 10 times, and after plate counting, multiple PCR reactions were performed to detect the sensitivity. The results are as follows: figure 1 , figure 2 as shown,

[0051] 2. Specificity test

[0052] After resuscitating and culturing rabbit Pasteurella, Bordetella, Salmonella, Escherichia coli, Clostridium welchii, etc., extract DNA for specificity test. The result is as image 3 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of diagnosis of bacterial diseases of poultry, in particular to a primer group and a kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and a detection method thereof. The kit comprises 7 freezing tubes, wherein two freezing tubes are respectively filled with a 2*PCR core reagent premix, and the other five freezing tubes are respectively filled with rabbit Pasteurella multocida DNA solution, Bordetella bronchiseptica positive DNA solution, DL2000 molecular weight standard solution, ddH2O and a primermixture used by a PCR system. The detection method for the kit comprises the following steps of: 1, providing DNA of a sample to be detected; and 2, taking the kit, amplifying the DNA of the sample to be detected by adopting the conventional PCR method, detecting an amplification result by adopting an agarose gel electrophoresis method, and judging according to the result. The multiple PCR detection method established by the invention is specific, sensitive, simple, convenient and quick, can be used for quickly detecting clinical samples and investigating molecular epidemiology of the rabbit Pasteurella multocida and Bordetella bronchiseptica.

Description

technical field [0001] The invention relates to the technical field of diagnosis of livestock bacterial diseases, in particular to a primer set and a kit for multiplex PCR detection of Pasteurella rabbits and Bordetella rabbits and a detection method thereof. Background technique [0002] Rabbit Pasteurellosis is a polymorphic infectious disease caused by Pasteurella multocida. Pasteurellosis in rabbits can be divided into: rhinitis type, epidemic pneumonia, sepsis, pyometra, Guwan inflammation, otitis media and conjunctivitis according to the different parts of infection. The acute outbreak of pasteurellosis in rabbits will cause a large number of deaths of rabbits. Chronic infection will cause relapse or mixed infection, which cannot be cured, and will bring economic losses to the rabbit industry. It is listed as a key point of control. One of the rabbit diseases. Rabbit Bordetella is a multiple respiratory disease caused by Bordetella bornchispetica (Bb), mainly causing...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/04C12Q1/68C12N15/11
Inventor 刘燕鲍国连韦强季权安肖琛闻章春桃
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More