Mutation screening probe of SLC25A13 gene and application thereof

A mutation screening and probe technology, applied in the fields of medicine and biology, can solve the problems that judgment is highly dependent on the quality of electrophoresis and personal experience, the cost of gene scanning screening methods is expensive, and there are many operating procedures, achieving high scientific research and clinical The effect of use value, intuitive judgment, and simple operation

Inactive Publication Date: 2011-03-30
CHILDRENS HOSPITAL OF FUDAN UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Since the mutation only lacks four bases, the fragments are observed by agarose gel electrophoresis, and the difference is small. The judgment of the result is highly dependent on

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutation screening probe of SLC25A13 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method

[0032] 1. Routine extraction of genomic DNA from peripheral blood.

[0033] 2. Primer and probe design

[0034] Upstream primer: TTGGTATATTTGTTGCTTGTGTTT (SEQ ID NO 1)

[0035] Downstream primer: TTAAAGGGCAGAGTTCCCTCT (SEQ ID NO 2)

[0036] Normal sequence probe: FAM-CCTACAGACGTATGACCTTAGCA-TAMRA (SEQ ID NO 3)

[0037] Mutant sequence probe: HEX-CCTACAGACGACCTTAGCAGA-TAMRA. (SEQ ID NO 4)

[0038] 3. Reaction system (25ul)

[0039] 2.5×Real Mix 10ul

[0040] Upstream primer (10Um) 0.5ul

[0041] Downstream primer (10UM) 0.5ul

[0042] FAM labeled probe (10UM) 0.25ul

[0043] HEX (10UM) labeled probe 0.25ul

[0044] 20×Enhancer 1.25ul

[0045] ddH2O 10.25ul

[0046] Genomic DNA template 2ul

[0047] 4. Reaction conditions

[0048]

[0049]5. Judgment of results

[0050] No 851del4 mutation: only FAM-marked curves take off, HEX-marked curves do not

[0051] There are 851del4...

Embodiment 2

[0055] Screening of 400 infants with intrahepatic cholestasis in the Children's Hospital of Fudan University, a total of 8 cases of homozygous mutation, 30 cases of heterozygous mutation were detected, and the remaining 362 cases had no 851del4 mutation.

[0056] In order to further verify the accuracy of this method, ordinary PCR was re-conducted on the screened 4 cases of homozygous mutations, 20 cases of heterozygous mutations and 14 cases of normal sequences, and the products were directly sequenced, and the sequencing results were combined with software reading and manual verification analysis , all the sequencing results are completely consistent with the results of the double-labeled fluorescent probe PCR method, which proves that the accuracy of the method reaches 100%, and no false positive or false negative occurs in the detection results of the method.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the medicine and biotechnology field and relates to a mutation screening probe of SLC25A13 gene and application thereof. The invention provides the mutation screening probe of the SLC25A13 gene and the nucleotide coding sequence of the probe is shown in SEQ ID NO 4. The invention also provides application of the probe, namely a mutation screening method of the SLC25A13 gene. The method comprises the following steps: using the genome DNA in the sample as the template and adding the forward primer and reverse primer of the mutation site of the SLC25A13 gene and the marked normal sequence probe and mutation screening probe to carry out polymerase chain reaction; and determining whether the sample is mutant by detecting the marker in the reaction product. The probe has the characteristics of simple and direct operation, time saving, intuitive and definite result judgment, lower cost and pollution reduction.

Description

technical field [0001] The invention belongs to the field of medicine and biotechnology, and relates to a mutation screening probe of SLC25A13 gene and its application. Background technique [0002] Mutations in the SLC25A13 gene can lead to at least two common disease types, adult citrullinemia type II (CTLN2) and infantile intrahepatic cholestasis (NICCD). [0003] Type II citrullinemia in adults is mainly manifested by neurological symptoms, such as disorientation, seizures, mental abnormalities, etc., and some patients are also accompanied by pancreatitis or liver tumors. The vast majority of patients died of progressive cerebral edema several years after the onset of the disease, and the effect of conservative medical treatment was poor. At present, the most effective treatment is liver transplantation. [0004] Infantile intrahepatic cholestasis (NICCD) occurs in newborns or infants, and the main manifestations of the children are jaundice, abnormal liver function, gr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11G01N21/64
Inventor 王建设付海燕
Owner CHILDRENS HOSPITAL OF FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap