Mutation screening probe of SLC25A13 gene and application thereof
A mutation screening and probe technology, applied in the fields of medicine and biology, can solve the problems that judgment is highly dependent on the quality of electrophoresis and personal experience, the cost of gene scanning screening methods is expensive, and there are many operating procedures, achieving high scientific research and clinical The effect of use value, intuitive judgment, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method
[0032] 1. Routine extraction of genomic DNA from peripheral blood.
[0033] 2. Primer and probe design
[0034] Upstream primer: TTGGTATATTTGTTGCTTGTGTTT (SEQ ID NO 1)
[0035] Downstream primer: TTAAAGGGCAGAGTTCCCTCT (SEQ ID NO 2)
[0036] Normal sequence probe: FAM-CCTACAGACGTATGACCTTAGCA-TAMRA (SEQ ID NO 3)
[0037] Mutant sequence probe: HEX-CCTACAGACGACCTTAGCAGA-TAMRA. (SEQ ID NO 4)
[0038] 3. Reaction system (25ul)
[0039] 2.5×Real Mix 10ul
[0040] Upstream primer (10Um) 0.5ul
[0041] Downstream primer (10UM) 0.5ul
[0042] FAM labeled probe (10UM) 0.25ul
[0043] HEX (10UM) labeled probe 0.25ul
[0044] 20×Enhancer 1.25ul
[0045] ddH2O 10.25ul
[0046] Genomic DNA template 2ul
[0047] 4. Reaction conditions
[0048]
[0049]5. Judgment of results
[0050] No 851del4 mutation: only FAM-marked curves take off, HEX-marked curves do not
[0051] There are 851del4...
Embodiment 2
[0055] Screening of 400 infants with intrahepatic cholestasis in the Children's Hospital of Fudan University, a total of 8 cases of homozygous mutation, 30 cases of heterozygous mutation were detected, and the remaining 362 cases had no 851del4 mutation.
[0056] In order to further verify the accuracy of this method, ordinary PCR was re-conducted on the screened 4 cases of homozygous mutations, 20 cases of heterozygous mutations and 14 cases of normal sequences, and the products were directly sequenced, and the sequencing results were combined with software reading and manual verification analysis , all the sequencing results are completely consistent with the results of the double-labeled fluorescent probe PCR method, which proves that the accuracy of the method reaches 100%, and no false positive or false negative occurs in the detection results of the method.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
