High-efficiency ammonium-excreting combined azotobacter strain

A high-efficiency technology for nitrogen fixation, applied in the direction of bacteria, microorganism-based methods, microorganisms, etc., can solve the problems of limiting the development and application of nitrogen-fixing bacteria

Inactive Publication Date: 2011-05-04
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This limits the development of combined nitrogen-fixing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency ammonium-excreting combined azotobacter strain
  • High-efficiency ammonium-excreting combined azotobacter strain
  • High-efficiency ammonium-excreting combined azotobacter strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1a

[0037] Example 1 amtB mutant strain construction

[0038] 1) Amplification of amtB1 gene homologous fragment

[0039] Using A1501 total DNA as a template, respectively

[0040] 5′-ACAGGATCCTCTGTTAAGCCCAGGCTT-3′

[0041] 5′-GGGAGGCTTATTGAAGTTGGTGACGCC-3

[0042] Carry out PCR amplification for primers, amplify the DNA fragment that is used for constructing amtB gene mutant strain, the product is verified by agarose gel electrophoresis ( figure 1 ).

[0043] 2) Construction of amtB1 gene integration mutants

[0044] Homologous fragments obtained by PCR were digested and connected to the multiple cloning sites of the digested plasmid pK18mob to obtain recombinant plasmids. After the recombinant plasmid was identified by enzyme digestion, it was introduced into the recipient strain P. stuteri A1501 through triparental conjugation, so that the plasmid had homologous single exchange on the target gene, integrated into the chromosome, and the triparental zygote was obtained by ...

Embodiment 2

[0049] Example 2 Construction and verification of 1561 / pVA3 strain

[0050] 1. Cloning of nifA gene molecules

[0051] The genome of Pseudomonas stutzeri A1501 was extracted. Using the extracted genome as a template, PCR amplification was performed. The primers used were synthesized according to the 5' and 3' end sequences of the nifA gene, and the sequences of the two primers were:

[0052] 5' CCGAAGCTTTCAGATCTTGCGCATATGA 3' and

[0053] 5' CCGAAGCTTACGGTGCATATCGATAGC 3',

[0054] The about 1124bp fragment of phytase phyc gene was recovered by electrophoresis. The complete nifA gene is obtained by the PCR method, and includes a nucleotide sequence about 70 bp upstream of the coding region of the nifA gene, and a target fragment of 1.64 kb in length. Digest with HindIII and recover the target fragment, and connect it with the shuttle vector pVK100 digested with the same enzyme. Tc s Km r Resistance screening, plasmid extraction, HindIII and EcoRI digestion identificati...

Embodiment 3

[0058] The ammonium secretion comparison of embodiment 3 engineering bacterium 1561 / pVA3 and wild-type bacterial strain

[0059] 1) Determination of ammonium secretion by strains

[0060] NH 4 + The determination of concentration is according to indophenol blue colorimetric method (Bender et al.1977): A solution (100ml): 5g phenol; 0.025g Na-nitroprusside (Na 2 Fe[CN] 5 NO2H 2 O); B solution (100ml): 62.5ml 1M NaOH; 3.3ml NaOCl (available chlorine 5.25%). Take 100 μl bacterial culture supernatant, add 100 μl A solution, then add 100 μl B solution, observe the color depth of the reaction solution after 20 minutes to judge whether there is NH 4 + . Appropriately expand the volume and draw NH 4 + Standard curve (serial dilution of 1M NH 4 + 0.1, 0.2, 0.4, 0.6, 0.8, 1.0, 1.5, 2.0mM; after adding A and B solutions for 20min, the OD 625 Colorimetric). According to the standard curve, the NH in the supernatant can be known 4 + concentration.

[0061] 2) Results

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a novel high-efficiency ammonium-excreting combined azotobacter strain which is characterized in that amt B gene is deleted from the whole genome of Pseudomonas stutzeri A1501, and meanwhile, nif A gene is transferred in. The ammonium measurement test proves that the combined azotobacter strain can excrete ammonium at high efficiency and is a potential microbial fertilizer. The invention also provides a method for constructing the high-efficiency ammonium-excreting combined azotobacter strain, which comprises the steps of construction of complete set of expression vectors, triparental mating, screening of recombinants, and identification.

Description

Technical field: [0001] The invention relates to a high-efficiency ammonium-secreting combined nitrogen-fixing bacterial strain, and also relates to a construction method of the high-efficiency ammonium-secreting combined nitrogen-fixing bacterial strain. Background technique: [0002] Research on biological nitrogen fixation helps to increase food production without polluting the environment. Associative nitrogen-fixing bacteria is an important group of nitrogen-fixing organisms. However, due to the loose association between associative nitrogen-fixing bacteria and plants, a stable symbiotic structure has not been formed, so the nitrogen provided by them to plants is very limited. Ammonium secreting bacteria secrete ammonium to the extracellular environment to provide a certain amount of nitrogen for the host plant, so it has become a research hotspot for researchers at home and abroad. At present, the research on the growth-promoting effect of ammonium-secreting bacteria ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/78C12R1/38
Inventor 平淑珍燕永亮李燕何升樊颖陈明张维陆伟林敏
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap