Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof
A technology of mycobacterium tuberculosis and aptamer, applied in the field of microbial immunity and inspection, to achieve the effect of overcoming non-specificity, simple preparation, and high specificity of action
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Screening of DNA Adapters
[0032] The present invention has the screening method of the DNA aptamer that specifically binds virulence Mycobacterium tuberculosis H37Rv as follows:
[0033] 1: Construct a random single-stranded DNA library and primers. Construction of a single-stranded DNA library with a length of 88 bases: 5'-GCG GAATTC TAATACGACTCACTATAGGGAACA GTCCGAGCC-N30-GGGTCAATGCGTCATA-3', where N stands for A, T, C, G four random bases. The upstream primer is: 5'- GCGGAATTCTAATACGACTCAC TATAGGGAACAGTCCGAGCC-3', the underlined part is Eco DNA restriction site for RI; downstream primer: 5’-GCG GGATCC TATGACGCATTG ACCC-3’, the underlined part is Bam DNA restriction enzyme site for HI. Random single-stranded DNA library and primers can be synthesized by the company.
[0034] 2. PCR amplification and storage of double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) libraries: Before each round of screening, the ssDNA library is amplified into ...
Embodiment 2
[0039] Example 2 Application of Ma1 in the diagnosis of tuberculosis
[0040] Using Ma1 as a template, aptamers labeled with biotin and fluorescent FAM were amplified by PCR, and then ELISA and flow cytometry were used to measure the binding ability with different bacteria.
[0041] ELISA method:
[0042] (1) First use different bacteria (1X10 5 / well) to coat a 96-well plate, then overnight at 4°C.
[0043] (2) Wash 6 times with PBS containing 0.05% Tween-20;
[0044] (3) Add 100 µL of PBS containing salmon sperm DNA (100 µg / mL) to each well for blocking, 37°C for ? hours;
[0045] (4) Wash 6 times with PBS containing 0.05% Tween-20;
[0046] (5) Add 100 μL of biotin-labeled Ma1 (40 pmol) to each well, 37°C for 1 hour;
[0047] (6) Wash 6 times with PBS containing 0.05% Tween-20;
[0048] (7) Add 100 μL of HRP-labeled streptavidin diluted 1:1000 to each well, at 37°C for 30 minutes;
[0049] (8) TMB develops color for 10-20 minutes, and terminates the reaction with 0.5...
Embodiment 3
[0065] Example 3 Inhibition of Ma1 to Mycobacterium tuberculosis
[0066] use 10 7 CFU (400μl) of H37Rv infected Balb / c mice. The mice were divided into two groups, 6 in each group. The mice in the first group were not treated after infection, and the mice in the second group were treated with aptamer Ma1 after infection. Each mouse was injected with 5 μg of aptamer on three days, once every three days, for a total of three injections. All mice were injected into the tail vein, and H37Rv was passaged in mice before the experiment to ensure sufficient virulence.
[0067] Confirmed by acid-fast staining ( Figure 5 ), the bacterial load in the lungs of mice infected with Mycobacterium tuberculosis H37Rv was significantly reduced after the action of the aptamer Ma1 compared with the mice in the non-adapter group, where A is the infection of virulent Mycobacterium tuberculosis H37Rv The acid-fast staining of the lungs of the mice, B is the acid-fast staining of the lungs of the m...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap