High expression lipase gene and secretory expression vector and application thereof

A lipase gene and expression vector technology, applied in the field of genetic engineering, can solve the problems of low lipase expression and enzyme activity

Active Publication Date: 2011-06-01
SHANGHAI CUTSEQ BIOMEDICAL TECH CO LTD
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide a high-expression lipase gene to overcome the defects that the expression and enzyme activity of Pichia strain Rhizopus oryzae lipase are relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of pPIC9k-ProROL vector

[0029] The whole genome sequence of Rhizopus oryzae was extracted. Primers were designed for PCR reaction to obtain the coding sequence of Rhizopus oryzae lipase leader peptide and signal peptide gene (ProROL). The primer sequences are as follows:

[0030] ROL proF1: 5'-GCGGAATTCGTTCCTGTTTCTGGTAAATCTGG-3'

[0031] ROL proR1: 5'-ATAGCGGCCGCTTACAAACAGCTTCCTTCG-3'

[0032] The amplified sequence was connected with pMD19-T simple, and the competent cells of large intestine were transformed by heat shock method. Positive strains were amplified and cultured, and the pPIC9k E. coli strain was expanded at the same time. The plasmids were extracted from the two, digested with EcoRI and NotⅠ double enzymes, the target fragment was ligated overnight with T4 DNA ligase, and transformed into colon competent cells. Select positive strains to extract plasmids to obtain recombinant pPIC9k-ProROL plasmids.

Embodiment 2

[0033] Example 2: Overlap extension PCR to obtain high-expression lipase gene and electrotransformation

[0034] Culture recombinant Escherichia coli strains to extract plasmid pPIC9k-ProRCL (Wang Lele, Yu Xiaowei, Xu Yan, Rhizopus sinica ( Rhizopus chinensis ) cloning of leader peptide lipase gene and its expression in Pichia pastoris Expression in High Technology Communications, (2009), 19(10):105) and pPIC9k-ProROL, PCR reaction was carried out using the two as templates. Primers are as follows:

[0035] ROL-Mature F:

[0036] 5'-TCCTGCTACGTCCACTGCCCCCAGCTCTGATGGTGGTAAGG-3'

[0037] ProROL R: 5'-AATTCCAGTGCGGCCGCTTACAAACAGCTTCCTTCG-3'

[0038] ProRCL F: 5'- TCAAGATCCCTAGGGTTCCTGTTGGTCATAAAGGTTC -3'

[0039] RCL-PRO R: 5'-GCTGGGGGCAGTGGACGTAGCAGGAATAGG-3'

[0040] Using the pPIC9k-ProRCL plasmid as a template, the RCL-PRO R and ProRCL F primers were used to obtain the Rhizopus chinensis lipase leader peptide sequence RCL-Pro; using pPIC9k-ProROL as a template, ROL...

Embodiment 3

[0042] Embodiment 3: Recombinant screening and molecular verification

[0043] After electroporation, add 1 mL of sorbitol solution, revive at 30°C for 1 hour, and spread a YPD plate with a G418 concentration of 0.25 mg / mL. The grown single colony is inoculated with YPD liquid medium and expanded to extract the genome. Using the genome as a template and using ProRCLF and ProROL R as primers for PCR reaction, the 1092bp band was determined as a positive strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high expression lipase gene and a secretory expression vector thereof, belonging to the genetic engineering field. The DNA sequence of the lipase gene is SEQIDNO.1; or under strict condition, lipase gene DNA is a DNA molecule which hybridizes with DNA sequences limited by the SEQIDNO.1 and codes protein possessing lipase activity. The invention also discloses a method for producing lipase utilizing the lipase gene; constructed engineering bacteria overcome long term defects of low expression level and enzyme activity of the lipase. Enzyme activity can be as high as 123.4 U / mL in shaking flask fermentation, increasing about 11 times compared with that of initial recombinant strains; enzyme activity in 7 L pot fermentation methanol induction for 84h is about 7062.5 U / mL, increasing about 56.2 times compared with that of the shaking flask fermentation. The invention has a wide application prospect.

Description

technical field [0001] The invention relates to a high-expression lipase gene and its secretion expression vector and application, belonging to the field of genetic engineering. technical background [0002] Lipase (Lipase E.C.3.1.1.3) is a special type of esterase, the full name is Triacylglycerol acylhydrolase, which hydrolyzes triacylglycerides into fatty acids, diglycerides, monoglycerides and glycerol, and its natural substrates are generally insoluble in water Long-chain fatty acid acyl esters, characterized by catalytic action at the oil-water interface. The global lipase market is as high as 2 billion US dollars, and it is the third largest type of enzyme preparation after protease and amylase. Microorganisms are an important source of lipase, which have wider action pH and action temperature than animal and plant lipase, and are suitable for industrialized large-scale production. Most of the rhizopus lipases have good 1,3 position specificity. At present, more tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/16C12N15/63C12N5/10
Inventor喻晓蔚徐岩郭勇亮
OwnerSHANGHAI CUTSEQ BIOMEDICAL TECH CO LTD