High expression lipase gene and secretory expression vector and application thereof
A lipase gene and expression vector technology, applied in the field of genetic engineering, can solve the problems of low lipase expression and enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] Example 1: Construction of pPIC9k-ProROL vector
[0029] The whole genome sequence of Rhizopus oryzae was extracted. Primers were designed for PCR reaction to obtain the coding sequence of Rhizopus oryzae lipase leader peptide and signal peptide gene (ProROL). The primer sequences are as follows:
[0030] ROL proF1: 5'-GCGGAATTCGTTCCTGTTTCTGGTAAATCTGG-3'
[0031] ROL proR1: 5'-ATAGCGGCCGCTTACAAACAGCTTCCTTCG-3'
[0032] The amplified sequence was connected with pMD19-T simple, and the competent cells of large intestine were transformed by heat shock method. Positive strains were amplified and cultured, and the pPIC9k E. coli strain was expanded at the same time. The plasmids were extracted from the two, digested with EcoRI and NotⅠ double enzymes, the target fragment was ligated overnight with T4 DNA ligase, and transformed into colon competent cells. Select positive strains to extract plasmids to obtain recombinant pPIC9k-ProROL plasmids.
Embodiment 2
[0033] Example 2: Overlap extension PCR to obtain high-expression lipase gene and electrotransformation
[0034] Culture recombinant Escherichia coli strains to extract plasmid pPIC9k-ProRCL (Wang Lele, Yu Xiaowei, Xu Yan, Rhizopus sinica ( Rhizopus chinensis ) cloning of leader peptide lipase gene and its expression in Pichia pastoris Expression in High Technology Communications, (2009), 19(10):105) and pPIC9k-ProROL, PCR reaction was carried out using the two as templates. Primers are as follows:
[0035] ROL-Mature F:
[0036] 5'-TCCTGCTACGTCCACTGCCCCCAGCTCTGATGGTGGTAAGG-3'
[0037] ProROL R: 5'-AATTCCAGTGCGGCCGCTTACAAACAGCTTCCTTCG-3'
[0038] ProRCL F: 5'- TCAAGATCCCTAGGGTTCCTGTTGGTCATAAAGGTTC -3'
[0039] RCL-PRO R: 5'-GCTGGGGGCAGTGGACGTAGCAGGAATAGG-3'
[0040] Using the pPIC9k-ProRCL plasmid as a template, the RCL-PRO R and ProRCL F primers were used to obtain the Rhizopus chinensis lipase leader peptide sequence RCL-Pro; using pPIC9k-ProROL as a template, ROL...
Embodiment 3
[0042] Embodiment 3: Recombinant screening and molecular verification
[0043] After electroporation, add 1 mL of sorbitol solution, revive at 30°C for 1 hour, and spread a YPD plate with a G418 concentration of 0.25 mg / mL. The grown single colony is inoculated with YPD liquid medium and expanded to extract the genome. Using the genome as a template and using ProRCLF and ProROL R as primers for PCR reaction, the 1092bp band was determined as a positive strain.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com