Reference internal type dual-luciferase reporter vector and application thereof
A dual-luciferase and luciferase technology, applied in the fields of molecular biology and cell biology, can solve the problems of large intra-batch and inter-batch differences, increased material costs and labor, and easy misjudgment. , to achieve the effect of reducing the cost of experiments, improving repeatability and reliability, and having a wide range of applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Example 1 Design and synthesis of chimeric primers for cloning firefly luciferase gene
[0082] The sequence of the firefly luciferase gene comes from the reporter vector pGL3-promoter, which is planned to be cloned between the Renilla luciferase gene and the ampicillin resistance gene on the reporter vector pRL-TK. The chimera primer sequence used is:
[0083] pF-Fluc(SEQ ID No: 1)
[0084] 5’ AAGGATCCAGGTGGCACTTTTCG
[0085] pR-Fluc(SEQ ID No: 2)
[0086] 5’ GAAAAATAAACAAATAGGGGTTCCGCGCAC
[0087]
[0088] P1R(SEQ ID No: 3)5’CGAAAAGTGCCACCTGGATCCTT3’
[0089] All primers are synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and are packed, transported and stored in dry powder form. The primers were diluted with TE buffer (ph=8.0) to a 10 μmol / L solution, and stored at -20°C for later use.
Embodiment 2
[0090] Example 2 One-step binary bridge coupling long-distance PCR amplification of the linear fusion fragment of the firefly luciferase gene and the reporter vector pRL-TK
[0091] i) Sources of reagents and materials
[0092] High-fidelity DNA polymerase KOD plus and its matching buffer (10×buffer), dNTP, magnesium sulfate MgSO 4 All were purchased from Toyobo Biotechnology Co., Ltd., the article number is KOD-201, and stored at -20°C. Reporting vectors pGL3-promoter and pRL-TK were purchased from Promega, USA, and were extracted and purified according to the instructions of the small extraction medium-volume ultrapure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd., and frozen at -20°C.
[0093] ii) The system composition is shown in Table 1.
[0094] Table 1 PCR components and concentration
[0095] Ingredients
The initial concentration
Dosage
Final concentration
PCR buffer
10×
5μl
1×
dNTP
2mmol / L
5μl
200μmol / L
Embodiment 3
[0104] Example 3 DpnI digests PCR products
[0105] The restriction endonuclease DpnI specifically recognizes and cleaves the methylated GATC sequence, purchased from Fermentas, Lithuania, catalog number ER1702. The composition of the reaction system is shown in Table 2.
[0106] Table 2 Dpn I digestion system
[0107] Ingredients
The initial concentration
Dosage
Final concentration
Buffer Tango TM
10×
3μl
1×
Dpn I
10units / μl
1μl
0.33unit / μl
PCR product
26μl
total capacity
30μl
[0108] Add the above ingredients one by one on ice and mix well.
[0109] Incubate in a 37°C water bath for 2h, and place on ice after completion for transformation.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
