Application of rice phosphate transport protein gene ORYsa;Pht1;4
A technology for transporting proteins and phosphates, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as environmental pollution, inability to meet plant phosphorus and other problems, and achieve the effect of high phosphorus utilization efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1. Obtainment of (gene) sequence
[0040] 1. ORYsa; Pht1; 4 gene coding region sequence acquisition
[0041] The applicant entered OsPT4 on the NCBI website (www.ncbi.nlm.nih.gov) to obtain a DNA sequence encoding the rice high-affinity phosphorus transporter gene with the sequence number AF536964. According to the requirements of Commission for Plant Gene Nomenclature of the International Society for Plant Molecular Biology, we named the DNA sequence ORYsa; Pht1;4. The analysis shows that the sequence of the full-length coding region of the gene (ie, the open reading frame, ORF) is SEQ ID NO.1, with a total length of 1617 bp, encoding 539 amino acids. This gene has no introns.
[0042] 2. ORYsa; Pht1; 4 gene promoter sequence acquisition
[0043] According to the obtained coding region sequence of ORYsa; Pht1; 4, the sequence of its promoter region (SEQ ID NO.7) was searched on the NCBI website (www.ncbi.nlm.nih.gov) and obtained.
Embodiment 2
[0044] Example 2. Identification of rice ORYsa by RT-PCR; Pht1; Spatio-temporal expression pattern of 4 genes
[0045] 1. Extraction of total RNA
[0046]The rice variety "Nipponbare" was selected, and the normal phosphorus supply (300 μM KH 2 PO 4 ) and low phosphorus (10 μM KH 2 PO 4 ) treatment, the leaves and roots were collected after 3 weeks, the total RNA was extracted with TriZol reagent, the quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectrophotometer.
[0047] 2. Identification of temporal and spatial expression patterns of ORYsa; Pht1; 4 genes
[0048] According to the coding sequence of the rice ORYsa; Pht1; 4 gene, the following ORYsa; Pht1; 4 gene-specific primers P1 and P2 were designed to amplify the length of 772 bp to identify the spatiotemporal expression pattern of the ORYsa; Pht1; 4 gene.
[0049] P1 ATCGTGGAGGAGCAGGAGAAGG (SEQ ID NO. 10)
[0050] P2 CATCGTCATCG...
Embodiment 3
[0053] Example 3. Using ORYsa; Pht1; 4 promoter + coding region + GUS transgenic rice plants to study the application prospect of ORYsa; Pht1; 4
[0054] The present invention utilizes the ORYsa; Pht1; 4 own promoter sequence to activate the coding region sequence of the gene.
[0055] 1. Cloning of the complete coding region sequence of ORYsa; Pht1; 4
[0056] The rice variety "Nipponbare" was selected, and the normal phosphorus supply (300 μM KH 2 PO 4 ) and low phosphorus (10 μM KH 2 PO 4 ) treatment, after 3 weeks, the materials (root tip, branch root occurrence area, rhizome junction and leaf) were collected, and the total RNA was extracted by TriZol reagent respectively, and the quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA was measured on a spectrophotometer content.
[0057] According to the full-length coding sequence of the rice ORYsa; Pht1; 4 gene, design primers to amplify the complete coding reading f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 