Unlock instant, AI-driven research and patent intelligence for your innovation.

Pegylated staphylokinase mutant, and preparation method and application thereof

A technology of PEGylation and polyethylene glycol, which is applied in the field of life sciences, can solve problems such as the decrease of peptide binding ability, and achieve the effects of decreased immunogenicity, reduced immunogenicity, high purity and yield

Inactive Publication Date: 2011-10-12
HEBEI NORMAL UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Further research found that the C3 region peptide contains two overlapping T cell epitope sequences, S1 (72-82) and S2 (75-85), among which the amino acids at Y73 and F76 are the key amino acids of the two epitopes, and they were replaced is A, the binding ability of peptides S1 and S2 to HLA-DR decreases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pegylated staphylokinase mutant, and preparation method and application thereof
  • Pegylated staphylokinase mutant, and preparation method and application thereof
  • Pegylated staphylokinase mutant, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Construction of staphylokinase mutant Sak (K74C) gene and prokaryotic expression plasmid

[0026] Using the site-directed mutagenesis technology based on the principle of PCR reaction, the expression plasmid vector pBV-Sak containing the wild-type Sak gene was used as a template, and the expression vector was amplified with completely complementary primers containing mutant bases, and then the methyl group was digested with Dpn I. After the template DNA (the linear vector of the PCR product does not contain methylation sites, so it will not be digested by Dpn I enzyme), it is directly transformed into competent Escherichia coli DH5α (prepared by conventional molecular biology methods), and the recombinants are inoculated Culture in LB medium containing 50-100 mg / ml ampicillin, and use a plasmid extraction kit (Beijing Dingguo Biotechnology Company) to extract the plasmid DNA of positive clones. The designed mutation was confirmed by restriction enzyme digestion and n...

Embodiment 2

[0053] 1. Construction of staphylokinase mutant Sak (E75C) gene and prokaryotic expression plasmid

[0054] The construction process of the staphylokinase mutant Sak (E75C) prokaryotic expression plasmid is basically the same as that of Sak (K74C), and the only difference is the difference in PCR amplification primers. The PCR amplification primers used by Sak (E75C) are:

[0055] Sak(E75C):

[0056] Primer 1: GCGACAGCATAAATGTTTTAGAGTAGTTG

[0057] Primer 2: CAACTACTCTAAAACATTTATATGCTGTCGC

[0058] The monoclonal screening process of DH5α, JF1125, JM109 and BL21 engineered bacteria of Sak(E75C) is the same as that of Sak(K74C), and the expression products also exist in the form of intracellular soluble.

[0059] 2. Induced expression of engineered bacteria

[0060] The highly expressed bacterial strain of Sak (E75C) will be screened by shake flask as engineering bacteria, then with 2L fermentation shake flask in M 9 Low-density fermentation was carried out in CA, the cells...

Embodiment 3

[0072] 1. Construction of staphylokinase mutant Sak (R77C) gene and prokaryotic expression plasmid

[0073] The construction process of the prokaryotic expression plasmid of staphylokinase mutant Sak (R77C) is basically the same as that of Sak (K74C), the difference is only the difference of PCR amplification primers, and the PCR amplification primers used by Sak (R77C) are:

[0074] Sak(R77C):

[0075] Primer 1: GCATATAAAGAGTTTTGTGTAGTTGAATTAGATC

[0076] Primer 2: GATCTAATTCAACTACACAAAAACTCTTTATATGC

[0077] The monoclonal screening process of DH5α, JF1125, JM109 and BL21 engineered bacteria of Sak(R77C) is the same as that of Sak(K74C), and the expression products also exist in the form of intracellular soluble.

[0078] 2. Induced expression of engineered bacteria

[0079] The highly expressed bacterial strain of Sak (R77C) will be screened by shake flask as engineering bacteria, then with 2L fermentation shake flask in M 9 Low-density fermentation was carried out in C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pegylated staphylokinase mutant. The pegylated staphylokinase mutant is prepared by the following steps of: performing site directed mutagenesis on any one of hydrophilic amino acids in the 71st to 87th site amino acid sequences of wild type staphylokinase; substituting cysteine for the hydrophilic amino acid; performing high-efficiency expression in escherichia coli; purifying a staphylokinase mutant by chromatography; and performing site directed modification on the cysteine in the staphylokinase mutant by using methoxy maleimide polyethylene glycol to obtain the pegylated staphylokinase mutant. In the prepared pegylated staphylokinase mutant, the immunogenicity is obviously reduced; in vivo plasma half-life is obviously prolonged; medicament effect is durable; and fibrinolytic activity of dissolving thrombus is basically remained. The pegylated staphylokinase mutant can be used as a thrombolytic therapy medicament for a thromboembolic disease.

Description

technical field [0001] The invention relates to a pegylated staphylokinase mutant and its preparation method and application, belonging to the technical field of life sciences. Background technique [0002] Natural staphylokinase (staphylokinase, Sak) is a protein derived from Staphylococcus aureus, consisting of 136 amino acids. Sak is an "indirect" plasminogen activator, which cannot directly convert plasminogen (Plg) into plasmin (plasmin, Plm), but first binds to plasminogen in a 1:1 ratio. The inactive complex Sak·plg is formed. Under the activation of a small amount of plasmin, the active site of plasminogen is exposed, and the single-chain becomes double-chain plasmin, forming an active Sak·plm complex, which is further activated The plasminogen molecule is transformed into plasmin, which dissolves the fibrin of the thrombus matrix to dissolve the thrombus. In plasma, Sak·plm is quickly inhibited by α2-antiplasmin and does not activate the fibrinolytic system; when ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/48C12N15/63C12N1/21A61K38/49A61K47/48A61P7/02
Inventor 贺进田刘建伟王改珍
Owner HEBEI NORMAL UNIV